epsA

epsA
168

extracellular polysaccharide synthesis, putative transmembrane modulator of EpsB activity, might activate EpsB autophosphorylation and substrate phosphorylation

Locus
BSU_34370
Molecular weight
25.75 kDa
Isoelectric point
6.07
Protein length
234 aaSequenceBlast
Gene length
705 bpSequenceBlast
Function
biofilm formation
Product
unknown
Essential
no
Synonyms
epsA, yveK
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3944 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,529,151 → 3,529,855
The protein
Protein family
CapA family (with CapA and TkmA, according to UniProt)
CpsC/CapA family (with TkmA, according to UniProt)
Structure
P71050 (AlphaFold)
Paralogous protein(s)
TkmA
Localization
cell membrane (according to UniProt)
Expression and Regulation
Operons
Genes
epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO
Description
PubMed
Regulation
repressed by SinR PubMed
Regulatory mechanism
RemA: activation, PubMed, in remA regulon
AbrB: repression, PubMed, in abrB regulon
SinR: anti-activation, (prevents binding of RemA) PubMed, in sinR regulon
EAR riboswitch: processive antitermination, in EAR riboswitch
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
induction by sequestration of SinR by SinI or SlrA PubMed
Open in new tab

epsA→epsO

2025-04-02 11:08:39

ghost

150

972f8e32dbf02ccc05ec1b86b52f3e7c715bf4da

DAC70A15EA1F43CB18727990D26DF72F59759165

Biological materials
Mutant
MGNA-A073 (yveK::erm), available at the NBRP B. subtilis, Japan
GP1517 (aphA3) PubMed, available in Jörg Stülke's lab
GP1519 (''epsA-epsB'', aphA3) PubMed, available in Jörg Stülke's lab
GP1567 ''epsA::aphA3 tkmA''::spc PubMed, available in Jörg Stülke's lab
BKE34370 (ΔepsA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTATTCATAGCCTTCAG,  downstream forward: _UP4_AAACATTTCGGGGAGTGAAG
BKK34370 (ΔepsA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTATTCATAGCCTTCAG,  downstream forward: _UP4_AAACATTTCGGGGAGTGAAG
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH) PubMed, available in Jörg Stülke's lab
FLAG-tag construct
GP1526 epsA-FLAG 3x spc (based on pGP1331) PubMed, available in Jörg Stülke's lab
Antibody
**
GFP fusion
GP1569 epsA-gfp (spc), available in Jörg Stülke's lab
Labs working on this gene/protein
Richard Losick, Harvard Univ., Cambridge, USA homepage
References
Reviews
Marvasi M, Visscher PT, Casillas Martinez L Exopolymeric substances (EPS) from Bacillus subtilis: polymers and genes encoding their synthesis. FEMS microbiology letters. 2010 Dec; 313(1):1-9. doi:10.1111/j.1574-6968.2010.02085.x. PMID:20735481
Original Publications
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Martin M, Dragoš A, Otto SB, Schäfer D, Brix S, Maróti G, Kovács ÁTCheaters shape the evolution of phenotypic heterogeneity in Bacillus subtilis biofilms.The ISME journal. 2020 Sep; 14(9):2302-2312. PMID: 32483306
Gao T, Greenwich J, Li Y, Wang Q, Chai Y The Bacterial Tyrosine Kinase Activator TkmA Contributes to Biofilm Formation Largely Independently of the Cognate Kinase PtkA in Bacillus subtilis. Journal of bacteriology. 2015 Nov; 197(21):3421-32. doi:10.1128/JB.00438-15. PMID:26283769
Elsholz AK, Wacker SA, Losick R Self-regulation of exopolysaccharide production in Bacillus subtilis by a tyrosine kinase. Genes & development. 2014 Aug 01; 28(15):1710-20. doi:10.1101/gad.246397.114. PMID:25085422
Gerwig J, Kiley TB, Gunka K, Stanley-Wall N, Stülke J The protein tyrosine kinases EpsB and PtkA differentially affect biofilm formation in Bacillus subtilis. Microbiology (Reading, England). 2014 Apr; 160(Pt 4):682-91. doi:10.1099/mic.0.074971-0. PMID:24493247
Winkelman JT, Bree AC, Bate AR, Eichenberger P, Gourse RL, Kearns DB RemA is a DNA-binding protein that activates biofilm matrix gene expression in Bacillus subtilis. Molecular microbiology. 2013 Jun; 88(5):984-97. doi:10.1111/mmi.12235. PMID:23646920
Diethmaier C, Pietack N, Gunka K, Wrede C, Lehnik-Habrink M, Herzberg C, Hübner S, Stülke J A novel factor controlling bistability in Bacillus subtilis: the YmdB protein affects flagellin expression and biofilm formation. Journal of bacteriology. 2011 Nov; 193(21):5997-6007. doi:10.1128/JB.05360-11. PMID:21856853
Lehnik-Habrink M, Schaffer M, Mäder U, Diethmaier C, Herzberg C, Stülke J RNA processing in Bacillus subtilis: identification of targets of the essential RNase Y. Molecular microbiology. 2011 Sep; 81(6):1459-73. doi:10.1111/j.1365-2958.2011.07777.x. PMID:21815947
Chumsakul O, Takahashi H, Oshima T, Hishimoto T, Kanaya S, Ogasawara N, Ishikawa S Genome-wide binding profiles of the Bacillus subtilis transition state regulator AbrB and its homolog Abh reveals their interactive role in transcriptional regulation. Nucleic acids research. 2011 Jan; 39(2):414-28. doi:10.1093/nar/gkq780. PMID:20817675
Chai Y, Norman T, Kolter R, Losick R An epigenetic switch governing daughter cell separation in Bacillus subtilis. Genes & development. 2010 Apr 15; 24(8):754-65. doi:10.1101/gad.1915010. PMID:20351052
Kobayashi K SlrR/SlrA controls the initiation of biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Sep; 69(6):1399-410. doi:10.1111/j.1365-2958.2008.06369.x. PMID:18647168
Chai Y, Chu F, Kolter R, Losick R Bistability and biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Jan; 67(2):254-63. . PMID:18047568
Chu F, Kearns DB, Branda SS, Kolter R, Losick R Targets of the master regulator of biofilm formation in Bacillus subtilis. Molecular microbiology. 2006 Feb; 59(4):1216-28. . PMID:16430695
Kearns DB, Chu F, Branda SS, Kolter R, Losick R A master regulator for biofilm formation by Bacillus subtilis. Molecular microbiology. 2005 Feb; 55(3):739-49. . PMID:15661000

F6C4634BF871D9A01E27014FFED7527C54BF560D

Page visits: 8638

Time of last update: 2025-04-05 18:59:53

Author of last update: Jstuelk