rnjB

rnjB
168

RNase J2

Locus
BSU_16780
Molecular weight
56.67 kDa
Isoelectric point
9.18
Protein length
555 aaSequenceBlast
Gene length
1668 bpSequenceBlast
Function
RNA processing and degradation
Product
RNase J2
Essential
no
Synonyms
rnjB, ymfA
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0595 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,749,418 → 1,751,085
Phenotypes of a mutant
growth advantage at low pressure and at 27°C at normal pressure (has been selected at low pressure) PubMed
The protein
Catalyzed reaction/ biological activity
endoribonuclease, involved in processing of ''thrS'' mRNA
Protein family
metallo-beta-lactamase superfamily (according to UniProt)
RNase J subfamily (according to UniProt)
Structure
3ZQ4 (PDB), RNase J1, 49% identity, 81% similarity PubMed
O31760 (AlphaFold)
Paralogous protein(s)
RnjA
Localization
cytoplasm, colocalizes with the ribosomes PubMed
Expression and Regulation
Operons
Genes
rnjB
Description
PubMed
Regulation
constitutive expression PubMed
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

rnjB

2025-03-29 19:34:10

ghost

75

66c326bcc376993734796ad2ba0768266f905477

09B108FF8F2780B6C9057C169FC47AF565F4E5BE

Biological materials
Mutant
MGNA-B114 (ymfA::erm), available at the NBRP B. subtilis, Japan
GP1113 (rnjB::miniTn10 spc), available in Jörg Stülke's lab
GP1291 (ΔrnjB::cat), available in Jörg Stülke's lab
BKE16780 (ΔrnjB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAAATCTATATCCTCCTAG,  downstream forward: _UP4_TAATGACTGACTAAAGACCG
BKK16780 (ΔrnjB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAAATCTATATCCTCCTAG,  downstream forward: _UP4_TAATGACTGACTAAAGACCG
Expression vectors
GP1687, chromosomal expression of rnjB-Strep::kan in B. subtilis, available in Jörg Stülke's lab
GP1724, chromosomal expression of rnjB-Strep::spc in B. subtilis, based on pGP1389, available in Jörg Stülke's lab
pGP1438: IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844, available in Jörg Stülke's lab
pGP1440: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed
FLAG-tag construct
GP1001 (spc, based on pGP1331), available in Jörg Stülke's lab
LacZ fusion
pGP419 (in pAC7), available in Jörg Stülke's lab
GFP fusion
GP1695 (in pHJS-105 PubMed), expression of  rnjB-sfGFP::spc under a xylose-inducible promoter in B. subtilis, available in Jörg Stülke's lab PubMed
GP1699 (in pBP43), expression of  rnjB-GFP::spc under the native promoter, available in Jörg Stülke's lab PubMed
Labs working on this gene/protein
Harald Putzer, IBPC Paris, France Homepage
References
Reviews
Condon C, Pellegrini O, Gilet L, Durand S, Braun FWalking from E. coli to B. subtilis, one ribonuclease at a time.Comptes rendus biologies. 2021 Dec 20; 344(4):357-371. PMID: 35787606
Bechhofer DH, Deutscher MP Bacterial ribonucleases and their roles in RNA metabolism. Critical reviews in biochemistry and molecular biology. 2019 Jun; 54(3):242-300. doi:10.1080/10409238.2019.1651816. PMID:31464530
Durand S, Condon C RNases and Helicases in Gram-Positive Bacteria. Microbiology spectrum. 2018 Apr; 6(2). doi:10.1128/microbiolspec.RWR-0003-2017. PMID:29651979
Redder P Molecular and genetic interactions of the RNA degradation machineries in Firmicute bacteria. Wiley interdisciplinary reviews. RNA. 2018 Jan 05; . doi:10.1002/wrna.1460. PMID:29314657
Dominski Z, Carpousis AJ, Clouet-d'Orval B Emergence of the β-CASP ribonucleases: highly conserved and ubiquitous metallo-enzymes involved in messenger RNA maturation and degradation. Biochimica et biophysica acta.; 1829(6-7):532-51. doi:10.1016/j.bbagrm.2013.01.010. pii:S1874-9399(13)00020-5. PMID:23403287
Lehnik-Habrink M, Lewis RJ, Mäder U, Stülke J RNA degradation in Bacillus subtilis: an interplay of essential endo- and exoribonucleases. Molecular microbiology. 2012 Jun; 84(6):1005-17. doi:10.1111/j.1365-2958.2012.08072.x. PMID:22568516
Bechhofer DH Bacillus subtilis mRNA decay: new parts in the toolkit. Wiley interdisciplinary reviews. RNA.; 2(3):387-94. doi:10.1002/wrna.66. PMID:21957024
Richards J, Belasco JG Ribonuclease J: how to lead a double life. Structure (London, England : 1993). 2011 Sep 07; 19(9):1201-3. doi:10.1016/j.str.2011.08.004. PMID:21893280
Condon C What is the role of RNase J in mRNA turnover? RNA biology.; 7(3):316-21. . PMID:20458164
Original Publications
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Oviedo-Bocanegra LM, Hinrichs R, Rotter DAO, Dersch S, Graumann PLSingle molecule/particle tracking analysis program SMTracker 2.0 reveals different dynamics of proteins within the RNA degradosome complex in Bacillus subtilis.Nucleic acids research. 2021 Aug 20; . PMID: 34417617
Raj R, Mitra S, Gopal B Characterization of Staphylococcus epidermidis Polynucleotide phosphorylase and its interactions with ribonucleases RNase J1 and RNase J2. Biochemical and biophysical research communications. 2018 Jan 08; 495(2):2078-2084. pii:S0006-291X(17)32450-6. doi:10.1016/j.bbrc.2017.12.056. PMID:29242153
Zheng X, Feng N, Li D, Dong X, Li J New molecular insights into an archaeal RNase J reveal a conserved processive exoribonucleolysis mechanism of the RNase J family. Molecular microbiology. 2017 Aug 10; . doi:10.1111/mmi.13769. PMID:28795788
Gao P, Pinkston KL, Bourgogne A, Murray BE, van Hoof A, Harvey BR Functional studies of E. faecalis RNase J2 and its role in virulence and fitness. PloS one. 2017; 12(4):e0175212. doi:10.1371/journal.pone.0175212. PMID:28384222
Cascante-Estepa N, Gunka K, Stülke J Localization of Components of the RNA-Degrading Machine in Bacillus subtilis. Frontiers in microbiology. 2016; 7:1492. . PMID:27708634
Waters SM, Zeigler DR, Nicholson WL Experimental evolution of enhanced growth by Bacillus subtilis at low atmospheric pressure: genomic changes revealed by whole-genome sequencing. Applied and environmental microbiology. 2015 Nov; 81(21):7525-32. doi:10.1128/AEM.01690-15. PMID:26296725
Jamalli A, Hébert A, Zig L, Putzer H Control of expression of the RNases J1 and J2 in Bacillus subtilis. Journal of bacteriology. 2014 Jan; 196(2):318-24. doi:10.1128/JB.01053-13. PMID:24187087
Newman JA, Hewitt L, Rodrigues C, Solovyova A, Harwood CR, Lewis RJ Unusual, dual endo- and exonuclease activity in the degradosome explained by crystal structure analysis of RNase J1. Structure (London, England : 1993). 2011 Sep 07; 19(9):1241-51. doi:10.1016/j.str.2011.06.017. PMID:21893285
Deikus G, Bechhofer DH 5' End-independent RNase J1 endonuclease cleavage of Bacillus subtilis model RNA. The Journal of biological chemistry. 2011 Oct 07; 286(40):34932-40. doi:10.1074/jbc.M111.287409. PMID:21862575
Mathy N, Hébert A, Mervelet P, Bénard L, Dorléans A, Li de la Sierra-Gallay I, Noirot P, Putzer H, Condon C Bacillus subtilis ribonucleases J1 and J2 form a complex with altered enzyme behaviour. Molecular microbiology. 2010 Jan; 75(2):489-98. doi:10.1111/j.1365-2958.2009.07004.x. PMID:20025672
Yao S, Bechhofer DH Processing and stability of inducibly expressed rpsO mRNA derivatives in Bacillus subtilis. Journal of bacteriology. 2009 Sep; 191(18):5680-9. doi:10.1128/JB.00740-09. PMID:19633085
Commichau FM, Rothe FM, Herzberg C, Wagner E, Hellwig D, Lehnik-Habrink M, Hammer E, Völker U, Stülke J Novel activities of glycolytic enzymes in Bacillus subtilis: interactions with essential proteins involved in mRNA processing. Molecular & cellular proteomics : MCP. 2009 Jun; 8(6):1350-60. doi:10.1074/mcp.M800546-MCP200. PMID:19193632
Mäder U, Zig L, Kretschmer J, Homuth G, Putzer H mRNA processing by RNases J1 and J2 affects Bacillus subtilis gene expression on a global scale. Molecular microbiology. 2008 Oct; 70(1):183-96. doi:10.1111/j.1365-2958.2008.06400.x. PMID:18713320
Li de la Sierra-Gallay I, Zig L, Jamalli A, Putzer H Structural insights into the dual activity of RNase J. Nature structural & molecular biology. 2008 Feb; 15(2):206-12. doi:10.1038/nsmb.1376. PMID:18204464
Even S, Pellegrini O, Zig L, Labas V, Vinh J, Bréchemmier-Baey D, Putzer H Ribonucleases J1 and J2: two novel endoribonucleases in B.subtilis with functional homology to E.coli RNase E. Nucleic acids research. 2005; 33(7):2141-52. . PMID:15831787

B73CE26E7AEFACFA82C67F3E7DBBB3F766F739CA

Page visits: 4318

Time of last update: 2025-04-06 15:51:23

Author of last update: Jstuelk