sigL
168

sigma factor of the RNA polymerase, Sigma-54, Sigma L

Locus

BSU_34200

Molecular weight

49.54 kDa

Isoelectric point

7.79

Protein length

436 aaSequenceBlast

Gene length

1311 bpSequenceBlast

Function

utilization of arginin, acetoin and fructose, required for cold adaptation

Product

RNA polymerase sigma-54 factor (sigma-L)

Essential

Synonyms

sigL

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1508 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene

Coordinates

3,512,498 3,513,808

Phenotypes of a mutant

The mutant is cold-sensitive and unable to use arginine as a single carbon source PubMed

The protein

Catalyzed reaction/ biological activity

Binding to promoters of the -12, -24 type

Protein family

sigma-54 factor family (single member, according to UniProt)

Domains

DNA binding domain (HTH motif) (324343)

pron box domain (413421)

3 x Compositional bias domain (621),(3253),(112136)

Structure

5BYH (PDB) (E. coli RNA polymerase containing Sigma-54) PubMed

P24219 (AlphaFold)

Additional information

Transcription initiation by SigL-containing RNA polymerase requires the activity of ATP-hydrolyzing transcription activators

information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

Genes

sigL

Description

PubMed

Regulation

repressed by glucose (CcpA) PubMed

Regulatory mechanism

CcpA: repression, transcriptional roadblock PubMed, in ccpA regulon

Open in new tab

Biological materials

Mutant

GP146 (ΔsigL::spc), available in Jörg Stülke's lab PubMed

GP2302 (ΔsigL::tet), available in Jörg Stülke's lab

1A914 (sigL::kan), PubMed, available at BGSC

BKE34200 (ΔsigL::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTTGCTCACTCCCCTTT, downstream forward: _UP4_TAAAATCCTCCCTAGACGGG

BKK34200 (ΔsigL::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTTGCTCACTCCCCTTT, downstream forward: _UP4_TAAAATCCTCCCTAGACGGG

Expression vectors

pGP3707: expression of Strep-sigL by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab

pGP3714: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab

FLAG-tag construct

pGP3798 for the construction of sigL-3xFLAG spc (based on pGP1331), available in Jörg Stülke's lab

Labs working on this gene/protein

Michel Debarbouille, Pasteur Institute, Paris, France Homepage

References

Reviews

Zhang N, Buck M A perspective on the enhancer dependent bacterial RNA polymerase. Biomolecules. 2015 May 21; 5(2):1012-9. doi:10.3390/biom5021012. PMID:26010401

Joly N, Zhang N, Buck M, Zhang X Coupling AAA protein function to regulated gene expression. Biochimica et biophysica acta. 2012 Jan; 1823(1):108-16. doi:10.1016/j.bbamcr.2011.08.012. PMID:21906631

Shingler V Signal sensory systems that impact σ⁵⁴ -dependent transcription. FEMS microbiology reviews. 2011 May; 35(3):425-40. doi:10.1111/j.1574-6976.2010.00255.x. PMID:21054445

Buck M, Gallegos MT, Studholme DJ, Guo Y, Gralla JD The bacterial enhancer-dependent sigma(54) (sigma(N)) transcription factor. Journal of bacteriology. 2000 Aug; 182(15):4129-36. . PMID:10894718

Merrick MJ In a class of its own--the RNA polymerase sigma factor sigma 54 (sigma N). Molecular microbiology. 1993 Dec; 10(5):903-9. . PMID:7934866

Original Publications

Mueller AU, Chen J, Wu M, Chiu C, Nixon BT, Campbell EA, Darst SAA general mechanism for transcription bubble nucleation in bacteria.Proceedings of the National Academy of Sciences of the United States of America. 2023 Apr 4; 120(14):e2220874120. PMID: 36972428

Yang Y, Darbari VC, Zhang N, Lu D, Glyde R, Wang YP, Winkelman JT, Gourse RL, Murakami KS, Buck M, Zhang X TRANSCRIPTION. Structures of the RNA polymerase-σ54 reveal new and conserved regulatory strategies. Science (New York, N.Y.). 2015 Aug 21; 349(6250):882-5. doi:10.1126/science.aab1478. PMID:26293966

Sharma A, Leach RN, Gell C, Zhang N, Burrows PC, Shepherd DA, Wigneshweraraj S, Smith DA, Zhang X, Buck M, Stockley PG, Tuma R Domain movements of the enhancer-dependent sigma factor drive DNA delivery into the RNA polymerase active site: insights from single molecule studies. Nucleic acids research. 2014 Apr; 42(8):5177-90. doi:10.1093/nar/gku146. PMID:24553251

Marciniak BC, Pabijaniak M, de Jong A, Dűhring R, Seidel G, Hillen W, Kuipers OP High- and low-affinity cre boxes for CcpA binding in Bacillus subtilis revealed by genome-wide analysis. BMC genomics. 2012 Aug 17; 13:401. doi:10.1186/1471-2164-13-401. PMID:22900538

Wiegeshoff F, Beckering CL, Debarbouille M, Marahiel MA Sigma L is important for cold shock adaptation of Bacillus subtilis. Journal of bacteriology. 2006 Apr; 188(8):3130-3. . PMID:16585774

Choi SK, Saier MH Regulation of sigL expression by the catabolite control protein CcpA involves a roadblock mechanism in Bacillus subtilis: potential connection between carbon and nitrogen metabolism. Journal of bacteriology. 2005 Oct; 187(19):6856-61. . PMID:16166551

Ali NO, Bignon J, Rapoport G, Debarbouille M Regulation of the acetoin catabolic pathway is controlled by sigma L in Bacillus subtilis. Journal of bacteriology. 2001 Apr; 183(8):2497-504. . PMID:11274109

Débarbouillé M, Martin-Verstraete I, Kunst F, Rapoport G The Bacillus subtilis sigL gene encodes an equivalent of sigma 54 from gram-negative bacteria. Proceedings of the National Academy of Sciences of the United States of America. 1991 Oct 15; 88(20):9092-6. . PMID:1924373

Page visits: 7357

Time of last update: 2025-04-06 15:51:27

Author of last update: Jstuelk

sigL 168

sigL
168