recR

recR
168

required for the formation of RecA DNA repair centers

Locus
BSU_00210
Molecular weight
21.83 kDa
Isoelectric point
5.3
Protein length
198 aaSequenceBlast
Gene length
597 bpSequenceBlast
Function
DNA repair/ recombination
Product
formation of RecA DNA repair centers
Essential
no
Synonyms
recR, recM
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

List of homologs in different organisms, belongs to COG0353 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
28,867 → 29,463
Phenotypes of a mutant
drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) PubMed
The protein
Catalyzed reaction/ biological activity
required for the formation of RecA DNA repair centers (together with RecO) PubMed
Protein family
RecR family (single member, according to UniProt)
Domains
TOPRIM domain (aa 80-175) PubMed
Structure
3VDP (PDB) (from Caldanaerobacter subterraneus subsp. tengcongensis MB4, 64.3% identity) PubMed
2V1C (PDB) (the RecR-RecO complex from Deinococcus radiodurans, RecR: 52% identity, 78% similarity, RecO: 30%/ 58%)  PubMed
P24277 (AlphaFold)
Localization
cytoplasm (homogeneous) PubMed
Expression and Regulation
Operons
Genes
dnaX-yaaK-recR-yaaL-bofA
Description
PubMed
Open in new tab

dnaX→bofA

2025-04-04 19:45:06

Jstuelk

152

1a32cdecddaee24171f48459041fdcb062bafc36

7EC4B7D4D9D0E5E8848420FD5562059E4207233C

Additional information
the mRNA is very stable (> 15 min) PubMed
Biological materials
Mutant
BKE00210 (ΔrecR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTCTTTTATCCCCCTA,  downstream forward: _UP4_TTGTAAGGAGGAAAAAGCGA
BKK00210 (ΔrecR::kan  trpC2) available at BGSC and in Jörg Stülke's lab,  PubMed, upstream reverse: _UP1_CATGTTCTTTTATCCCCCTA,  downstream forward: _UP4_TTGTAAGGAGGAAAAAGCGA
References
Reviews
Carrasco B, Torres R, Moreno-Del Álamo M, Ramos C, Ayora S, Alonso JCProcessing of stalled replication forks in Bacillus subtilis.FEMS microbiology reviews. 2023 Dec 5; . PMID: 38052445
Sinha AK, Possoz C, Leach DRF The roles of bacterial DNA double-strand break repair proteins in chromosomal DNA replication. FEMS microbiology reviews. 2020 Apr 14; . pii:fuaa009. doi:10.1093/femsre/fuaa009. PMID:32286623
Lenhart JS, Schroeder JW, Walsh BW, Simmons LA DNA repair and genome maintenance in Bacillus subtilis. Microbiology and molecular biology reviews : MMBR. 2012 Sep; 76(3):530-64. doi:10.1128/MMBR.05020-11. PMID:22933559
Original Publications
Lenhart JS, Brandes ER, Schroeder JW, Sorenson RJ, Showalter HD, Simmons LA RecO and RecR are necessary for RecA loading in response to DNA damage and replication fork stress. Journal of bacteriology. 2014 Aug; 196(15):2851-60. doi:10.1128/JB.01494-14. PMID:24891441
Vlašić I, Mertens R, Seco EM, Carrasco B, Ayora S, Reitz G, Commichau FM, Alonso JC, Moeller R Bacillus subtilis RecA and its accessory factors, RecF, RecO, RecR and RecX, are required for spore resistance to DNA double-strand break. Nucleic acids research. 2014 Feb; 42(4):2295-307. doi:10.1093/nar/gkt1194. PMID:24285298
Vlašić I, Mertens R, Seco EM, Carrasco B, Ayora S, Reitz G, Commichau FM, Alonso JC, Moeller R Bacillus subtilis RecA and its accessory factors, RecF, RecO, RecR and RecX, are required for spore resistance to DNA double-strand break. Nucleic acids research. 2014 Feb; 42(4):2295-307. doi:10.1093/nar/gkt1194. PMID:24285298
Tang Q, Gao P, Liu YP, Gao A, An XM, Liu S, Yan XX, Liang DCRecOR complex including RecR N-N dimer and RecO monomer displays a high affinity for ssDNA.Nucleic acids research. 2012 Nov; 40(21):11115-25. PMID: 23019218
Timmins J, Leiros I, McSweeney S Crystal structure and mutational study of RecOR provide insight into its mode of DNA binding. The EMBO journal. 2007 Jul 11; 26(13):3260-71. . PMID:17581636
Meile JC, Wu LJ, Ehrlich SD, Errington J, Noirot P Systematic localisation of proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new proteins at the DNA replication factory. Proteomics. 2006 Apr; 6(7):2135-46. . PMID:16479537
Hambraeus G, von Wachenfeldt C, Hederstedt L Genome-wide survey of mRNA half-lives in Bacillus subtilis identifies extremely stable mRNAs. Molecular genetics and genomics : MGG. 2003 Aug; 269(5):706-14. . PMID:12884008
Aravind L, Leipe DD, Koonin EV Toprim--a conserved catalytic domain in type IA and II topoisomerases, DnaG-type primases, OLD family nucleases and RecR proteins. Nucleic acids research. 1998 Sep 15; 26(18):4205-13. . PMID:9722641
Ayora S, Stiege AC, Alonso JC RecR is a zinc metalloprotein from Bacillus subtilis 168. Molecular microbiology. 1997 Feb; 23(4):639-47. . PMID:9157236
Ayora S, Stiege AC, Lurz R, Alonso JC Bacillus subtilis 168 RecR protein-DNA complexes visualized as looped structures. Molecular & general genetics : MGG. 1997 Mar 18; 254(1):54-62. . PMID:9108290
Alonso JC, Stiege AC, Dobrinski B, Lurz R Purification and properties of the RecR protein from Bacillus subtilis 168. The Journal of biological chemistry. 1993 Jan 15; 268(2):1424-9. . PMID:8419343

BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29

Page visits: 6157

Time of last update: 2025-04-10 20:19:49

Author of last update: Jstuelk