ywlE

ywlE
168

protein arginine phosphatase

Locus
BSU_36930
Molecular weight
16.64 kDa
Isoelectric point
6.68
Protein length
150 aaSequenceBlast
Gene length
453 bpSequenceBlast
Function
dephosphorylation of McsB
Product
protein arginine phosphatase
Essential
no
E.C.
3.1.3.48
Synonyms
ywlE, ipc-31d
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0394 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,791,805  3,792,257
Phenotypes of a mutant
impaired spore germination PubMed
The protein
Catalyzed reaction/ biological activity
Protein arginine phosphate + H2O --> protein arginine + phosphate PubMed
Protein family
low molecular weight phosphotyrosine protein phosphatase family (with ArsC and YfkJ, according to UniProt)
Structure
1ZGG (PDB)
P39155 (AlphaFold)
Effectors of protein activity
activity is inhibited by oxidative stress PubMed
Paralogous protein(s)
YfkJ
Localization
weak oligomerization, results in inactivation of YwlE PubMed
Expression and Regulation
Operons
Genes
ywlD-ywlE-ywlF-ywlG
Description
PubMed
Open in new tab

ywlD→ywlG

2025-03-17 20:10:54

Jstuelk

130

78d3ea170d5a096ed935a0bae51120c6b96770c1

58F865E725DD290FE4DA109529748B35ABC8310F

Genes
ywlE-ywlF-ywlG
Description
PubMed
Open in new tab

ywlE→ywlG

2025-04-04 02:02:48

Jstuelk

99

4e928c421cc36003d43336f1b2a8ad6da5bb87e9

EE90CA1B239C34BDD25117ADD762430875D6B755

Biological materials
Mutant
MGNA-A186 (ywlE::erm), available at the NBRP B. subtilis, Japan
ywlE::aphA3 available from Ulf Gerth's lab
ywlE::tet available from Ulf Gerth's lab
ywlE::spec available from Ulf Gerth's lab
GP1458 (ywlE::aphA3), available in Jörg Stülke's lab
GP1459 (ywlE::tet), available in Jörg Stülke's and Fabian Commichau's labs PubMed
BKE36930 (ywlE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTCAGTCACCCCTTATT,  downstream forward: _UP4_TAAGTTGTCAGAAAATCTGC
BKK36930 (ywlE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTCAGTCACCCCTTATT,  downstream forward: _UP4_TAAGTTGTCAGAAAATCTGC
Expression vectors
for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Ulf Gerth's lab
expression of native ywlE in B. subtilis: pBP183 (in pBQ200), available in Fabian Commichau's lab
Antibody
available in Ulf Gerth's lab
Labs working on this gene/protein
Ulf Gerth, Greifswald, Germany
Fabian Commichau Göttingen, Germany homepage
References
Reviews
Elsholz AKW, Birk MS, Charpentier E, Turgay K Functional Diversity of AAA+ Protease Complexes in Bacillus subtilis. Frontiers in molecular biosciences. 2017; 4:44. doi:10.3389/fmolb.2017.00044. PMID:28748186
Suskiewicz MJ, Clausen T Chemical Biology Interrogates Protein Arginine Phosphorylation. Cell chemical biology. 2016 Aug 18; 23(8):888-90. doi:10.1016/j.chembiol.2016.08.003. pii:S2451-9456(16)30248-3. PMID:27541193
Original Publications
Zhang J, Yang P, Zeng Q, Zhang Y, Zhao Y, Wang L, Li Y, Wang Z, Wang QArginine kinase McsB and ClpC complex impairs the transition to biofilm formation in Bacillus subtilis.Microbiological research. 2024 Nov 29; 292:127979. PMID: 39674004
Ogura MGlucose-Mediated Protein Arginine Phosphorylation/Dephosphorylation Regulates ylxR Encoding Nucleoid-Associated Protein and Cell Growth in Bacillus subtilis.Frontiers in microbiology. 2020; 11:590828. PMID: 33101263
Huang B, Zhao Z, Huang C, Zhao M, Zhang Y, Liu Y, Liao X, Huang S, Zhao YRole of metal cations and oxyanions in the regulation of protein arginine phosphatase activity of YwlE from Bacillus subtilis.Biochimica et biophysica acta. General subjects. 2020 Nov; 1864(11):129698. PMID: 32730774
Zhou B, Semanjski M, Orlovetskie N, Bhattacharya S, Alon S, Argaman L, Jarrous N, Zhang Y, Macek B, Sinai L, Ben-Yehuda S Arginine dephosphorylation propels spore germination in bacteria. Proceedings of the National Academy of Sciences of the United States of America. 2019 Jun 20; . pii:201817742. doi:10.1073/pnas.1817742116. PMID:31221751
Fuhrmann J, Subramanian V, Kojetin DJ, Thompson PR Activity-Based Profiling Reveals a Regulatory Link between Oxidative Stress and Protein Arginine Phosphorylation. Cell chemical biology. 2016 Aug 18; 23(8):967-977. pii:S2451-9456(16)30237-9. doi:10.1016/j.chembiol.2016.07.008. PMID:27524296
Stannek L, Gunka K, Care RA, Gerth U, Commichau FM Factors that mediate and prevent degradation of the inactive and unstable GudB protein in Bacillus subtilis. Frontiers in microbiology. 2014; 5:758. doi:10.3389/fmicb.2014.00758. PMID:25610436
Trentini DB, Fuhrmann J, Mechtler K, Clausen T Chasing Phosphoarginine Proteins: Development of a Selective Enrichment Method Using a Phosphatase Trap. Molecular & cellular proteomics : MCP. 2014 Aug; 13(8):1953-64. doi:10.1074/mcp.O113.035790. PMID:24825175
Schmidt A, Trentini DB, Spiess S, Fuhrmann J, Ammerer G, Mechtler K, Clausen T Quantitative phosphoproteomics reveals the role of protein arginine phosphorylation in the bacterial stress response. Molecular & cellular proteomics : MCP. 2014 Feb; 13(2):537-50. doi:10.1074/mcp.M113.032292. PMID:24263382
Fuhrmann J, Subramanian V, Thompson PR Targeting the arginine phosphatase YwlE with a catalytic redox-based inhibitor. ACS chemical biology. 2013 Sep 20; 8(9):2024-32. doi:10.1021/cb4001469. PMID:23838530
Fuhrmann J, Mierzwa B, Trentini DB, Spiess S, Lehner A, Charpentier E, Clausen T Structural basis for recognizing phosphoarginine and evolving residue-specific protein phosphatases in gram-positive bacteria. Cell reports. 2013 Jun 27; 3(6):1832-9. doi:10.1016/j.celrep.2013.05.023. pii:S2211-1247(13)00240-4. PMID:23770242
Elsholz AK, Turgay K, Michalik S, Hessling B, Gronau K, Oertel D, Mäder U, Bernhardt J, Becher D, Hecker M, Gerth U Global impact of protein arginine phosphorylation on the physiology of Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2012 May 08; 109(19):7451-6. doi:10.1073/pnas.1117483109. PMID:22517742
Elsholz AK, Hempel K, Michalik S, Gronau K, Becher D, Hecker M, Gerth U Activity control of the ClpC adaptor McsB in Bacillus subtilis. Journal of bacteriology. 2011 Aug; 193(15):3887-93. doi:10.1128/JB.00079-11. PMID:21622759
Elsholz AK, Michalik S, Zühlke D, Hecker M, Gerth U CtsR, the Gram-positive master regulator of protein quality control, feels the heat. The EMBO journal. 2010 Nov 03; 29(21):3621-9. doi:10.1038/emboj.2010.228. PMID:20852588
Blobel J, Bernadó P, Xu H, Jin C, Pons M Weak oligomerization of low-molecular-weight protein tyrosine phosphatase is conserved from mammals to bacteria. The FEBS journal. 2009 Aug; 276(16):4346-57. doi:10.1111/j.1742-4658.2009.07139.x. PMID:19678837
Xu H, Xia B, Jin C Solution structure of a low-molecular-weight protein tyrosine phosphatase from Bacillus subtilis. Journal of bacteriology. 2006 Feb; 188(4):1509-17. . PMID:16452434
Musumeci L, Bongiorni C, Tautz L, Edwards RA, Osterman A, Perego M, Mustelin T, Bottini N Low-molecular-weight protein tyrosine phosphatases of Bacillus subtilis. Journal of bacteriology. 2005 Jul; 187(14):4945-56. . PMID:15995210
Mijakovic I, Musumeci L, Tautz L, Petranovic D, Edwards RA, Jensen PR, Mustelin T, Deutscher J, Bottini N In vitro characterization of the Bacillus subtilis protein tyrosine phosphatase YwqE. Journal of bacteriology. 2005 May; 187(10):3384-90. . PMID:15866923

1BAD28287257F82F907706AFD2E8FF5F3BD1B57B

Page visits: 4860

Time of last update: 2025-04-06 04:25:54

Author of last update: Jstuelk