cwlT

cwlT
168

cell wall hydrolase, required for conjugation of ICEBs1, part of the type IV secretion system for DNA transfer , C-terminal domain hydrolyzes bond between D-Glu and m-DAP

Locus
BSU_04970
Molecular weight
36.39 kDa
Isoelectric point
8.63
Protein length
Gene length
Function
conjugative transfer of ICEBs1
Product
cell wall hydrolase
Synonyms
cwlT, yddH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0791 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
544,022  545,011
The protein
Catalyzed reaction/ biological activity
hydrolysis of peptidoglycan (linkage between N-acetylmuramic acid and N-acetylglucosamine and bond between D--glutamate and  meso-diaminopimelic acid) PubMed
degradation of gamma-polyglutamic acid PubMed
Protein family
Peptidase C40 family (according to UniProt)
N-terminal domain is an N-acetylmuramidase that cleaves the linkage between N-acetylmuramic acid and N-acetylglucosamine PubMed
C-terminal D,L-endopeptidase domain (NlpC/P60 domain) PubMed, cleaves the bond between D--glutamate and  meso-diaminopimelic acid PubMed
Structure
4FDY (PDB) (from Staphylococcus aureus, 42% identity) PubMed
Effectors of protein activity
both enzymatic activities are inhibited by interaction with IseA PubMed
secreted (with signal peptide) PubMed
may be a lipoprotein, but the lipid anchor is not required for function PubMed
Expression and Regulation
Operons
Description
Regulatory mechanism
ImmR: repression, PubMed, in immR regulon
Open in new tab

xis->yddJ

2025-04-04 00:35:31

Bzhu

88

9225e26ee70027d168e8ea0db13fb48c93ef1ef8

DE8D2BDC2F23AB45C58B0FE511E7B4816A65A489

Biological materials
Mutant
BKE04970 (cwlT::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_TATCATCTTGTTCTTTCATC,  downstream forward: _UP4_ATTAAATAACTAGGAGTGAA
BKK04970 (cwlT::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_TATCATCTTGTTCTTTCATC,  downstream forward: _UP4_ATTAAATAACTAGGAGTGAA
References
Rath H, Sappa PK, Hoffmann T, Salazar MG, Reder A, Steil L, Hecker M, Bremer E, Mäder U, Völker U Impact of high salinity and the compatible solute glycine betaine on gene expression of Bacillus subtilis. Environmental microbiology. 2020 May 17; . doi:10.1111/1462-2920.15087. PMID:32419322
Fukushima T, Uchida N, Ide M, Kodama T, Sekiguchi J DL-endopeptidases function as both cell wall hydrolases and poly-γ-glutamic acid hydrolases. Microbiology (Reading, England). 2018 Mar; 164(3):277-286. doi:10.1099/mic.0.000609. PMID:29458655
DeWitt T, Grossman AD The bifunctional cell wall hydrolase CwlT is needed for conjugation of the integrative and conjugative element ICEBs1 in Bacillus subtilis and B. anthracis. Journal of bacteriology. 2014 Apr; 196(8):1588-96. doi:10.1128/JB.00012-14. PMID:24532767
Xu Q, Chiu HJ, Farr CL, Jaroszewski L, Knuth MW, Miller MD, Lesley SA, Godzik A, Elsliger MA, Deacon AM, Wilson IA Structures of a bifunctional cell wall hydrolase CwlT containing a novel bacterial lysozyme and an NlpC/P60 DL-endopeptidase. Journal of molecular biology. 2014 Jan 09; 426(1):169-84. doi:10.1016/j.jmb.2013.09.011. pii:S0022-2836(13)00581-0. PMID:24051416
Fukushima T, Kitajima T, Yamaguchi H, Ouyang Q, Furuhata K, Yamamoto H, Shida T, Sekiguchi J Identification and characterization of novel cell wall hydrolase CwlT: a two-domain autolysin exhibiting n-acetylmuramidase and DL-endopeptidase activities. The Journal of biological chemistry. 2008 Apr 25; 283(17):11117-25. doi:10.1074/jbc.M706626200. PMID:18305117

8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F

Page visits: 5128

Time of last update: 2025-04-10 21:19:59

Author of last update: Jstuelk