ykuN

ykuN
168

flavodoxin, binds FMN, replaces ferredoxin under conditions of iron limitation, probably involved in electron transfer to nitric oxide synthase

Locus
BSU_14150
Molecular weight
17.65 kDa
Isoelectric point
3.83
Protein length
158 aaSequenceBlast
Gene length
477 bpSequenceBlast
Function
electron transfer
Product
flavodoxin
Essential
no
Synonyms
ykuN
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0716 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,487,038  1,487,514
The protein
Protein family
flavodoxin family (with YkuP, according to UniProt)
Domains
Flavodoxin-like domain (aa 4-144) (according to UniProt)
Cofactors
FMN PubMed
Structure
5LJL (PDB) (flavodoxin from Streptococcus pneumoniae, 42% identity) PubMed
O34737 (AlphaFold)
Paralogous protein(s)
YkuP
Expression and Regulation
Operons
Genes
ykuN-ykuO-ykuP
Description
PubMed
Regulation
expressed under anaerobic conditions (ResD) PubMed
induced by iron starvation (second wave) (Fur) PubMed
Regulatory mechanism
ResD: activation, PubMed, in resD regulon
Kre: repression, in kre regulon
NsrR: repression, PubMed, in nsrR regulon
Fur: repression, PubMed, in fur regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
SigI: sigma factor, PubMed, in sigI regulon
Additional information
the ''YkuN-YkuO-YkuP operon is strongly unregulated in a kre'' mutant PubMed
Open in new tab

ykuN→ykuP

2025-04-03 19:50:10

Jstuelk

97

57db5b9bbc0032750db2eb9bfdbed1110c747af0

E599E3DBF7B4049028BE0EE09C6A470E8B1A923E

Biological materials
Mutant
GP4733 ΔykuN::aphA3, available in Jörg Stülke's lab
MGNA-B337 (ykuN::erm), available at the NBRP B. subtilis, Japan
BKE14150 (ykuN::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTATCACCCCATTAGT,  downstream forward: _UP4_GATTATATGAACAAGGAAAA
BKK14150 (ykuN::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTATCACCCCATTAGT,  downstream forward: _UP4_GATTATATGAACAAGGAAAA
References
Zhou Y, Li B, Luo H, Chen C, Xu B, Li PEnzymatic colouring for meat without nitrite: Exploration of bacterial nitric oxide synthase fused with YkuN-YumC.Meat science. 2025 Feb 7; 223:109771. PMID: 39956041
Ly TTB, Thi Mai TT, Raffaele A, Urlacher VB, Nguyen TT, Hutter MC, Thi Vu HN, Thuy Le DT, Quach TN, Phi QTNew CYP154C4 from Streptomyces cavourensis YBQ59 performs regio- and stereo- selective 3β-hydroxlation of nootkatone.Archives of biochemistry and biophysics. 2024 Oct 29; 762:110192. PMID: 39481744
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Pisithkul T, Schroeder JW, Trujillo EA, Yeesin P, Stevenson DM, Chaiamarit T, Coon JJ, Wang JD, Amador-Noguez D Metabolic Remodeling during Biofilm Development of Bacillus subtilis. mBio. 2019 May 21; 10(3). pii:e00623-19. doi:10.1128/mBio.00623-19. PMID:31113899
Ramaniuk O, Převorovský M, Pospíšil J, Vítovská D, Kofroňová O, Benada O, Schwarz M, Šanderová H, Hnilicová J, Krásný L σ from : Impact on Gene Expression and Characterization of σ-dependent Transcription that Requires New Types of Promoters with Extended -35 and -10 Elements. Journal of bacteriology. 2018 Jun 18; . pii:JB.00251-18. doi:10.1128/JB.00251-18. PMID:29914988
Pi H, Helmann JD Sequential induction of Fur-regulated genes in response to iron limitation in Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2017 Nov 13; . pii:201713008. doi:10.1073/pnas.1713008114. PMID:29133393
Chumsakul O, Anantsri DP, Quirke T, Oshima T, Nakamura K, Ishikawa S, Nakano MM Genome-wide Identification of ResD, NsrR, and Fur Binding in Bacillus subtilis during Anaerobic Fermentative Growth by in vivo Footprinting. Journal of bacteriology. 2017 Apr 24; . pii:JB.00086-17. doi:10.1128/JB.00086-17. PMID:28439033
Rodríguez-Cárdenas Á, Rojas AL, Conde-Giménez M, Velázquez-Campoy A, Hurtado-Guerrero R, Sancho J Streptococcus pneumoniae TIGR4 Flavodoxin: Structural and Biophysical Characterization of a Novel Drug Target. PloS one. 2016; 11(9):e0161020. doi:10.1371/journal.pone.0161020. PMID:27649488
Gamba P, Jonker MJ, Hamoen LW A Novel Feedback Loop That Controls Bimodal Expression of Genetic Competence. PLoS genetics. 2015 Jun; 11(6):e1005047. doi:10.1371/journal.pgen.1005047. PMID:26110430
Bruender NA, Young AP, Bandarian V Chemical and Biological Reduction of the Radical SAM Enzyme 7-Carboxy-7-deazaguanine [corrected] Synthase. Biochemistry. 2015 May 12; 54(18):2903-10. doi:10.1021/acs.biochem.5b00210. PMID:25933252
Holden JK, Lim N, Poulos TL Identification of redox partners and development of a novel chimeric bacterial nitric oxide synthase for structure activity analyses. The Journal of biological chemistry. 2014 Oct 17; 289(42):29437-45. doi:10.1074/jbc.M114.595165. PMID:25194416
Henares B, Kommineni S, Chumsakul O, Ogasawara N, Ishikawa S, Nakano MM The ResD response regulator, through functional interaction with NsrR and fur, plays three distinct roles in Bacillus subtilis transcriptional control. Journal of bacteriology. 2014 Jan; 196(2):493-503. doi:10.1128/JB.01166-13. PMID:24214949
Chazarreta-Cifre L, Martiarena L, de Mendoza D, Altabe SG Role of ferredoxin and flavodoxins in Bacillus subtilis fatty acid desaturation. Journal of bacteriology. 2011 Aug; 193(16):4043-8. doi:10.1128/JB.05103-11. PMID:21665975
Girhard M, Klaus T, Khatri Y, Bernhardt R, Urlacher VB Characterization of the versatile monooxygenase CYP109B1 from Bacillus subtilis. Applied microbiology and biotechnology. 2010 Jun; 87(2):595-607. doi:10.1007/s00253-010-2472-z. PMID:20186410
Wang ZQ, Lawson RJ, Buddha MR, Wei CC, Crane BR, Munro AW, Stuehr DJ Bacterial flavodoxins support nitric oxide production by Bacillus subtilis nitric-oxide synthase. The Journal of biological chemistry. 2007 Jan 26; 282(4):2196-202. . PMID:17127770
Lawson RJ, von Wachenfeldt C, Haq I, Perkins J, Munro AW Expression and characterization of the two flavodoxin proteins of Bacillus subtilis, YkuN and YkuP: biophysical properties and interactions with cytochrome P450 BioI. Biochemistry. 2004 Oct 05; 43(39):12390-409. . PMID:15449930
Baichoo N, Wang T, Ye R, Helmann JD Global analysis of the Bacillus subtilis Fur regulon and the iron starvation stimulon. Molecular microbiology. 2002 Sep; 45(6):1613-29. . PMID:12354229

0932DDC285635C02067A3302CEDA302FE4269179

Page visits: 6283

Time of last update: 2025-04-05 14:18:41

Author of last update: Jstuelk