glmR

glmR
168

accessory uridyltransferase, regulator of carbon partitioning between central metabolism and peptidoglycan biosynthesis, control of cell shape, required for correct localization of PBP1

Locus
BSU_34760
Molecular weight
34.53 kDa
Isoelectric point
5.41
Protein length
317 aaSequenceBlast
Gene length
954 bpSequenceBlast
Function
regulation of carbon partitioning between central metabolism and peptidoglycan biosynthesis, localization of PBP1
Product
activator of GlmS activity
Essential
no
Synonyms
glmR, yvcK
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

List of homologs in different organisms, belongs to COG0391 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, WhiA regulon

Gene
Coordinates
3,570,546  3,571,499
Phenotypes of a mutant
unable to grow with gluconeogenic substrates as single carbon source, this can be suppressed by mutations in cggR, zwf, pgpH, ltaS, yfnI, upon overexpression of glmS or by a point mutation in PgcA (G47S) that results in increased phosphoglucosamine mutase activity PubMed
filamentous or L-shape-like aberrant morphologies (suppressed by Mg2+) PubMed, this is supressed by overexpression of MreB or by deletion of PBP1, ltaS, or yfnI PubMed
a pgcA glmR double mutant is not viable, this can be suppressed by overexpression of GlmM PubMed
inactivation suppresses the essentiality of mbl PubMed
The protein
Catalyzed reaction/ biological activity
GlcNAc-1P + UTP --> UDP-N-acetylglucosamine PubMed
stimulates GlmS activity to facilitate the diversion of carbon from fructose-6-phosphate to peptidoglycan synthesis PubMed
interacts with YvcJ to facilitate genetic transformation PubMed
Protein family
gluconeogenesis factor family (single member, according to UniProt)
Domains
phosphorylated on Thr-304 by PrkC, dephosphorylated by PrpC PubMed
Structure
2O2Z (PDB) (the protein from B. halodurans, 63% identity, 86% similarity)
O06974 (AlphaFold)
Effectors of protein activity
binds UDP-GlcNAc PubMed, this prevents the interaction with GlmS and stimulates interaction with YvcJ PubMed
Localization
localized as a helical-like pattern PubMed
Expression and Regulation
Operons
Genes
nahA-yvcJ-glmR-whiA-crh-yvcN
Description
PubMed
Regulation
constitutive expression at both protein and RNA levels PubMed
Expression
in Enterococcus faecalis: induced upon cell wall stress (vancomycin) (WhiA) PubMed
Regulatory mechanism
WhiA: transcription repression, described for Enterococcus faecalis PubMed, in whiA regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
A ncRNA is predicted between 'yvcI' and 'TrxB' PubMed
Open in new tab

nahA→yvcN

2025-04-03 12:06:53

Jstuelk

154

BCC5699F6256B8A1B7FD8A979DBBBC9D4D1198AB

9244FB113E998572106D983A19AB3AC81B9F9D35

Additional information
translation is likely to require Efp due to the presence of several consecutive proline residues PubMed
Biological materials
Mutant
MGNA-B640 (yvcK::erm), available at the NBRP B. subtilis, Japan
BKE34760 (ΔglmR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TGCGATTTTCGGCTTTTGTC,  downstream forward: _UP4_TGAAGCCTTGAAATGAGGTG
BKK34760 (ΔglmR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TGCGATTTTCGGCTTTTGTC,  downstream forward: _UP4_TGAAGCCTTGAAATGAGGTG
Expression vectors
pGP736 (N-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP380), available in Jörg Stülke's lab
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Boris Görke's lab
Labs working on this gene/protein
Anne Galinier, University of Marseille, France
References
Reviews
Galinier A, Delan-Forino C, Foulquier E, Lakhal H, Pompeo FRecent Advances in Peptidoglycan Synthesis and Regulation in Bacteria.Biomolecules. 2023 Apr 22; 13(5). PMID: 37238589
Galinier A, Foulquier E, Pompeo FMetabolic Control of Cell Elongation and Cell Division in Bacillus subtilis.Frontiers in microbiology. 2021; 12:697930. PMID: 34248920
Mignolet J, Viollier PH A sweet twist gets Bacillus into shape. Molecular microbiology. 2011 Apr; 80(2):283-5. doi:10.1111/j.1365-2958.2011.07588.x. PMID:21371139
Original Publications
Koo BM, Todor H, Sun J, van Gestel J, Hawkins JS, Hearne CC, Banta AB, Huang KC, Peters JM, Gross CAComprehensive double-mutant analysis of the Bacillus subtilis envelope using double-CRISPRi.bioRxiv : the preprint server for biology. 2024 Aug 16; . PMID: 39185233
Pensinger DA, Gutierrez KV, Smith HB, Vincent WJB, Stevenson DS, Black KA, Perez-Medina KM, Dillard JP, Rhee KY, Amador-Noguez D, Huynh TN, Sauer JDListeria monocytogenes GlmR Is an Accessory Uridyltransferase Essential for Cytosolic Survival and Virulence.mBio. 2023 Mar 20; :e0007323. PMID: 36939339
Foulquier E, Pompeo F, Byrne D, Fierobe HP, Galinier AUridine diphosphate N-acetylglucosamine orchestrates the interaction of GlmR with either YvcJ or GlmS in Bacillus subtilis.Scientific reports. 2020 Sep 29; 10(1):15938. PMID: 32994436
Patel V, Black KA, Rhee KY, Helmann JD Bacillus subtilis PgcA moonlights as a phosphoglucosamine mutase in support of peptidoglycan synthesis. PLoS genetics. 2019 Oct 07; 15(10):e1008434. doi:10.1371/journal.pgen.1008434. PMID:31589605
Pompeo F, Rismondo J, Gründling A, Galinier A Investigation of the phosphorylation of Bacillus subtilis LTA synthases by the serine/threonine kinase PrkC. Scientific reports. 2018 Nov 26; 8(1):17344. doi:10.1038/s41598-018-35696-7. PMID:30478337
Patel V, Wu Q, Chandrangsu P, Helmann JD A metabolic checkpoint protein GlmR is important for diverting carbon into peptidoglycan biosynthesis in Bacillus subtilis. PLoS genetics. 2018 Sep 24; 14(9):e1007689. doi:10.1371/journal.pgen.1007689. PMID:30248093
Foulquier E, Galinier A YvcK, a protein required for cell wall integrity and optimal carbon source utilization, binds uridine diphosphate-sugars. Scientific reports. 2017 Jun 23; 7(1):4139. doi:10.1038/s41598-017-04064-2. PMID:28646159
Pensinger DA, Boldon KM, Chen GY, Vincent WJ, Sherman K, Xiong M, Schaenzer AJ, Forster ER, Coers J, Striker R, Sauer JD The Listeria monocytogenes PASTA Kinase PrkA and Its Substrate YvcK Are Required for Cell Wall Homeostasis, Metabolism, and Virulence. PLoS pathogens. 2016 Nov; 12(11):e1006001. doi:10.1371/journal.ppat.1006001. PMID:27806131
Mir M, Prisic S, Kang CM, Lun S, Guo H, Murry JP, Rubin EJ, Husson RN Mycobacterial gene cuvA is required for optimal nutrient utilization and virulence. Infection and immunity. 2014 Oct; 82(10):4104-17. doi:10.1128/IAI.02207-14. PMID:25047842
Foulquier E, Pompeo F, Freton C, Cordier B, Grangeasse C, Galinier A PrkC-mediated phosphorylation of overexpressed YvcK protein regulates PBP1 protein localization in Bacillus subtilis mreB mutant cells. The Journal of biological chemistry. 2014 Aug 22; 289(34):23662-9. doi:10.1074/jbc.M114.562496. PMID:25012659
Foulquier E, Pompeo F, Bernadac A, Espinosa L, Galinier A The YvcK protein is required for morphogenesis via localization of PBP1 under gluconeogenic growth conditions in Bacillus subtilis. Molecular microbiology. 2011 Apr; 80(2):309-18. doi:10.1111/j.1365-2958.2011.07587.x. PMID:21320184
Görke B, Foulquier E, Galinier A YvcK of Bacillus subtilis is required for a normal cell shape and for growth on Krebs cycle intermediates and substrates of the pentose phosphate pathway. Microbiology (Reading, England). 2005 Nov; 151(Pt 11):3777-91. . PMID:16272399
Galinier A, Haiech J, Kilhoffer MC, Jaquinod M, Stülke J, Deutscher J, Martin-Verstraete I The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression. Proceedings of the National Academy of Sciences of the United States of America. 1997 Aug 05; 94(16):8439-44. . PMID:9237995

7150BABA5086D5E2EB8102E4901A216F43576282

Page visits: 7160

Time of last update: 2025-04-04 11:41:37

Author of last update: Jstuelk