wapA

wapA
168

cell wall-associated protein precursor, contact-dependent growth inhibition protein

Locus
BSU_39230
Molecular weight
258.02 kDa
Isoelectric point
6.13
Protein length
2334 aaSequenceBlast
Gene length
7005 bpSequenceBlast
Function
intercellular competition
Product
cell wall-associated protein precursor
Essential
no
Synonyms
wapA
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3209 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,023,544 → 4,030,548
Additional information
the gene readily acquires mutations during cultivation with Arabidopsis thaliana roots PubMed
The protein
Catalyzed reaction/ biological activity
the C-terminal toxic domain has RNase activity (cleaves tRNAs) PubMed
Protein family
RHS/WapA nuclease family (single member, according to UniProt)
Domains
cell wall binding domain as retention signal
C-terminal toxic domain with RNase activity (cleaves tRNAs) PubMed
Has two ligand-binding domains; the N-terminus has three 101 AA repeats which are responsible for cell wall binding; the C-terminus consists of two blocks of residues with a conserved motif repeated 31 times (according to UniProt)
Structure
Q07833 (AlphaFold)
Effectors of protein activity
WapI inhibits the toxic activity of WapA PubMed
Localization
extracellular (signal peptide), cell wall binding domain as retention signal, major constituent of the secretome PubMed
Expression and Regulation
Operons
Genes
wapA-wapI
Description
PubMed
Regulation
repressed at high salt concentration (DegU-P) PubMed
Expression
expression is heterogeneous PubMed
Regulatory mechanism
DegU: repression, DegU-P, PubMed, in degU regulon
YvrHb: activation, PubMed, in yvrHb regulon
WalR: repression, PubMed, in walR regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

wapA→wapI

2025-04-07 04:22:59

Jstuelk

159

ACCB16F95EA75BBC03E1DD4186EAB71F0DEDFADE

84D822AFD36349840C746076174D4353AE6A1D3C

Biological materials
Mutant
BKE39230 (ΔwapA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCTCTCTCCTTTTGT,  downstream forward: _UP4_TAATAAGGTTAAGCGAGGGG
BKK39230 (ΔwapA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCTCTCTCCTTTTGT,  downstream forward: _UP4_TAATAAGGTTAAGCGAGGGG
References
Hu G, Wang Y, Liu X, Strube ML, Wang B, Kovács ÁTSpecies and condition shape the mutational spectrum in experimentally evolved biofilms.mSystems. 2023 Sep 28; :e0054823. PMID: 37768063
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Mortier J, Van Riet S, Senovilla Herrero D, Vanoirbeek K, Aertsen AHigh-Throughput Time-Lapse Fluorescence Microscopy Screening for Heterogeneously Expressed Genes in Bacillus subtilis.Microbiology spectrum. 2022 Feb 23; 10(1):e0204521. PMID: 35171018
Rath H, Sappa PK, Hoffmann T, Salazar MG, Reder A, Steil L, Hecker M, Bremer E, Mäder U, Völker U Impact of high salinity and the compatible solute glycine betaine on gene expression of Bacillus subtilis. Environmental microbiology. 2020 May 17; . doi:10.1111/1462-2920.15087. PMID:32419322
Stempler O, Baidya AK, Bhattacharya S, Malli Mohan GB, Tzipilevich E, Sinai L, Mamou G, Ben-Yehuda S Interspecies nutrient extraction and toxin delivery between bacteria. Nature communications. 2017 Aug 22; 8(1):315. doi:10.1038/s41467-017-00344-7. PMID:28827522
Lyons NA, Kraigher B, Stefanic P, Mandic-Mulec I, Kolter R A Combinatorial Kin Discrimination System in Bacillus subtilis. Current biology : CB. 2016 Mar 21; 26(6):733-42. doi:10.1016/j.cub.2016.01.032. pii:S0960-9822(16)00082-8. PMID:26923784
Salzberg LI, Botella E, Hokamp K, Antelmann H, Maaß S, Becher D, Noone D, Devine KM Genome-wide analysis of phosphorylated PhoP binding to chromosomal DNA reveals several novel features of the PhoPR-mediated phosphate limitation response in Bacillus subtilis. Journal of bacteriology. 2015 Apr; 197(8):1492-506. doi:10.1128/JB.02570-14. PMID:25666134
Koskiniemi S, Lamoureux JG, Nikolakakis KC, t'Kint de Roodenbeke C, Kaplan MD, Low DA, Hayes CS Rhs proteins from diverse bacteria mediate intercellular competition. Proceedings of the National Academy of Sciences of the United States of America. 2013 Apr 23; 110(17):7032-7. doi:10.1073/pnas.1300627110. PMID:23572593
Salzberg LI, Powell L, Hokamp K, Botella E, Noone D, Devine KM The WalRK (YycFG) and σ(I) RsgI regulators cooperate to control CwlO and LytE expression in exponentially growing and stressed Bacillus subtilis cells. Molecular microbiology. 2013 Jan; 87(1):180-95. doi:10.1111/mmi.12092. PMID:23199363
Brown CT, Fishwick LK, Chokshi BM, Cuff MA, Jackson JM, Oglesby T, Rioux AT, Rodriguez E, Stupp GS, Trupp AH, Woollcombe-Clarke JS, Wright TN, Zaragoza WJ, Drew JC, Triplett EW, Nicholson WL Whole-genome sequencing and phenotypic analysis of Bacillus subtilis mutants following evolution under conditions of relaxed selection for sporulation. Applied and environmental microbiology. 2011 Oct; 77(19):6867-77. doi:10.1128/AEM.05272-11. PMID:21821766
Voigt B, Antelmann H, Albrecht D, Ehrenreich A, Maurer KH, Evers S, Gottschalk G, van Dijl JM, Schweder T, Hecker M Cell physiology and protein secretion of Bacillus licheniformis compared to Bacillus subtilis. Journal of molecular microbiology and biotechnology. 2009; 16(1-2):53-68. doi:10.1159/000142894. PMID:18957862
Ollinger J, Song KB, Antelmann H, Hecker M, Helmann JD Role of the Fur regulon in iron transport in Bacillus subtilis. Journal of bacteriology. 2006 May; 188(10):3664-73. . PMID:16672620
Serizawa M, Kodama K, Yamamoto H, Kobayashi K, Ogasawara N, Sekiguchi J Functional analysis of the YvrGHb two-component system of Bacillus subtilis: identification of the regulated genes by DNA microarray and northern blot analyses. Bioscience, biotechnology, and biochemistry. 2005 Nov; 69(11):2155-69. . PMID:16306698
Antelmann H, Yamamoto H, Sekiguchi J, Hecker M Stabilization of cell wall proteins in Bacillus subtilis: a proteomic approach. Proteomics. 2002 May; 2(5):591-602. . PMID:11987133
Dartois V, Débarbouillé M, Kunst F, Rapoport G Characterization of a novel member of the DegS-DegU regulon affected by salt stress in Bacillus subtilis. Journal of bacteriology. 1998 Apr; 180(7):1855-61. . PMID:9537385

BBC06DA57CAC2B2378763E0839C6C31AFBEA0417

Page visits: 8561

Time of last update: 2025-04-10 18:18:37

Author of last update: Jstuelk