slrR
168

cofactor of SinR blocking elongation of SigD-dependent flagellar genes, antagonist of SlrA and SinR, has LexA-like autocleavage activity

Locus

BSU_34380

Molecular weight

17.43 kDa

Isoelectric point

9.63

Protein length

152 aaSequenceBlast

Gene length

459 bpSequenceBlast

Function

regulation of initiation of biofilm formation and of autolysis

Product

transcriptional regulator (Xre family), SlrA antagonist

Essential

Synonyms

slrR, yveJ, slr

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factors/ other

Information processing, Regulation of gene expression, Transition state regulators

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation

Lifestyles, Exponential and early post-exponential lifestyles, Biofilm formation, Regulation

Lifestyles, Exponential and early post-exponential lifestyles, Swarming

List of homologs in different organisms, belongs to COG1396 (Galperin et al., 2021)

This gene is a member of the following regulons

AbrB regulon, SinR regulon, Abh regulon, SlrR regulon

Gene

Coordinates

3,530,101 3,530,559

Phenotypes of a mutant

smooth colonies on MsGG medium, no biofilm formation PubMed

The protein

Catalyzed reaction/ biological activity

SlrR binds to and inhibits the activity of SlrA, SlrA indirectly stimulates the synthesis of SlrR by interacting with SinR

SlrR can bind to SinR and SinR directly represses the transcription of SlrR

SlrR indirectly derepresses its own gene. The heterocomplex of SlrR-SinR binds within the fliE and fliI open reading frames to prevent transcription elongation PubMed

repression of transcription of ''lytA-lytB-lytC and lytF'' PubMed

autocleavage PubMed

Protein family

Xre family

Domains

HTH cro/C1-type domain (aa 6-61) (according to UniProt)

Sin domain (aa 113-151) (according to UniProt)

Structure

P71049 (AlphaFold)

Modification

subject to self-cleavage via a LexA-like autopeptidase, this involves ClpC and requires DegU PubMed

Effectors of protein activity

interaction with SinR triggers binding of SlrR to the promoters of ''lytA-lytB-lytC and lytF'', resulting in their repression PubMed

Paralogous protein(s)

SinR

Expression and Regulation

Operons

Genes

slrR-pnbA

Description

PubMed

Regulatory mechanism

Abh: activation, PubMed, in abh regulon

SinR: repression, PubMed, in sinR regulon

AbrB: repression, PubMed, in abrB regulon

Additional information

induction by sequestration of SinR by SinI, SlrA PubMed or by SlrR itself PubMed

Open in new tab

Biological materials

Mutant

MGNA-A089 (slr::erm), available at the NBRP B. subtilis, Japan

GP955 (slrR-''pnbA::cat''), available in Jörg Stülke's lab

BKE34380 (slrR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATATGAAATTCTCCTC, downstream forward: _UP4_TGATGATCGGTTAAAGGGCT

BKK34380 (slrR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATATGAAATTCTCCTC, downstream forward: _UP4_TGATGATCGGTTAAAGGGCT

Two-hybrid system

B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Reviews

Cairns LS, Hobley L, Stanley-Wall NR Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms. Molecular microbiology. 2014 Aug; 93(4):587-98. doi:10.1111/mmi.12697. PMID:24988880

Vlamakis H, Chai Y, Beauregard P, Losick R, Kolter R Sticking together: building a biofilm the Bacillus subtilis way. Nature reviews. Microbiology. 2013 Mar; 11(3):157-68. doi:10.1038/nrmicro2960. PMID:23353768

Piggot P Epigenetic switching: bacteria hedge bets about staying or moving. Current biology : CB. 2010 Jun 08; 20(11):R480-2. doi:10.1016/j.cub.2010.04.020. PMID:20541494

Original Publications

Gründling A, Brogan AP, James MJ, Ramirez-Guadiana FH, Roney IJ, Bernhardt TG, Rudner DZPgpP is a broadly conserved phosphatase required for phosphatidylglycerol lipid synthesis.Proceedings of the National Academy of Sciences of the United States of America. 2025 Feb 4; 122(5):e2418775122. PMID: 39869797

. . PMID: 39012109

Dannenberg S, Penning J, Simm A, Klumpp SThe motility-matrix production switch in Bacillus subtilis-a modeling perspective.Journal of bacteriology. 2023 Dec 13; :e0004723. PMID: 38088582

Chen Z, Zarazúa-Osorio B, Srivastava P, Fujita M, Igoshin OAThe Slowdown of Growth Rate Controls the Single-Cell Distribution of Biofilm Matrix Production via an SinI-SinR-SlrR Network.mSystems. 2023 Feb 14; :e0062222. PMID: 36786593

van Tilburg AY, Fülleborn JA, Reder A, Völker U, Stülke J, van Heel AJ, Kuipers OPUnchaining miniBacillus PG10: relief of FlgM-mediated repression of autolysin genes.Applied and environmental microbiology. 2021 Jul 7; :AEM0112321. PMID: 34232062

Lord ND, Norman TM, Yuan R, Bakshi S, Losick R, Paulsson J Stochastic antagonism between two proteins governs a bacterial cell fate switch. Science (New York, N.Y.). 2019 Oct 04; 366(6461):116-120. doi:10.1126/science.aaw4506. PMID:31604312

Hobley L, Li B, Wood JL, Kim SH, Naidoo J, Ferreira AS, Khomutov M, Khomutov A, Stanley-Wall NR, Michael AJ Spermidine promotes Bacillus subtilis biofilm formation by activating expression of the matrix regulator slrR. The Journal of biological chemistry. 2017 Jul 21; 292(29):12041-12053. doi:10.1074/jbc.M117.789644. PMID:28546427

Ogura M Post-transcriptionally generated cell heterogeneity regulates biofilm formation in Bacillus subtilis. Genes to cells : devoted to molecular & cellular mechanisms. 2016 Apr; 21(4):335-49. doi:10.1111/gtc.12343. PMID:26819068

Norman TM, Lord ND, Paulsson J, Losick R Memory and modularity in cell-fate decision making. Nature. 2013 Nov 28; 503(7477):481-6. doi:10.1038/nature12804. PMID:24256735

Newman JA, Rodrigues C, Lewis RJ Molecular basis of the activity of SinR protein, the master regulator of biofilm formation in Bacillus subtilis. The Journal of biological chemistry. 2013 Apr 12; 288(15):10766-78. doi:10.1074/jbc.M113.455592. PMID:23430750

Lei Y, Oshima T, Ogasawara N, Ishikawa S Functional analysis of the protein Veg, which stimulates biofilm formation in Bacillus subtilis. Journal of bacteriology. 2013 Apr; 195(8):1697-705. doi:10.1128/JB.02201-12. PMID:23378512

Cozy LM, Phillips AM, Calvo RA, Bate AR, Hsueh YH, Bonneau R, Eichenberger P, Kearns DB SlrA/SinR/SlrR inhibits motility gene expression upstream of a hypersensitive and hysteretic switch at the level of σ(D) in Bacillus subtilis. Molecular microbiology. 2012 Mar; 83(6):1210-28. doi:10.1111/j.1365-2958.2012.08003.x. PMID:22329926

Pozsgai ER, Blair KM, Kearns DB Modified mariner transposons for random inducible-expression insertions and transcriptional reporter fusion insertions in Bacillus subtilis. Applied and environmental microbiology. 2012 Feb; 78(3):778-85. doi:10.1128/AEM.07098-11. PMID:22113911

Diethmaier C, Pietack N, Gunka K, Wrede C, Lehnik-Habrink M, Herzberg C, Hübner S, Stülke J A novel factor controlling bistability in Bacillus subtilis: the YmdB protein affects flagellin expression and biofilm formation. Journal of bacteriology. 2011 Nov; 193(21):5997-6007. doi:10.1128/JB.05360-11. PMID:21856853

Chai Y, Kolter R, Losick R Reversal of an epigenetic switch governing cell chaining in Bacillus subtilis by protein instability. Molecular microbiology. 2010 Oct; 78(1):218-29. doi:10.1111/j.1365-2958.2010.07335.x. PMID:20923420

Chumsakul O, Takahashi H, Oshima T, Hishimoto T, Kanaya S, Ogasawara N, Ishikawa S Genome-wide binding profiles of the Bacillus subtilis transition state regulator AbrB and its homolog Abh reveals their interactive role in transcriptional regulation. Nucleic acids research. 2011 Jan; 39(2):414-28. doi:10.1093/nar/gkq780. PMID:20817675

Chai Y, Norman T, Kolter R, Losick R An epigenetic switch governing daughter cell separation in Bacillus subtilis. Genes & development. 2010 Apr 15; 24(8):754-65. doi:10.1101/gad.1915010. PMID:20351052

Chai Y, Kolter R, Losick R Paralogous antirepressors acting on the master regulator for biofilm formation in Bacillus subtilis. Molecular microbiology. 2009 Nov; 74(4):876-87. doi:10.1111/j.1365-2958.2009.06900.x. PMID:19788541

Murray EJ, Strauch MA, Stanley-Wall NR SigmaX is involved in controlling Bacillus subtilis biofilm architecture through the AbrB homologue Abh. Journal of bacteriology. 2009 Nov; 191(22):6822-32. doi:10.1128/JB.00618-09. PMID:19767430

Kobayashi K SlrR/SlrA controls the initiation of biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Sep; 69(6):1399-410. doi:10.1111/j.1365-2958.2008.06369.x. PMID:18647168

Chu F, Kearns DB, McLoon A, Chai Y, Kolter R, Losick R A novel regulatory protein governing biofilm formation in Bacillus subtilis. Molecular microbiology. 2008 Jun; 68(5):1117-27. doi:10.1111/j.1365-2958.2008.06201.x. PMID:18430133

Page visits: 7953

Time of last update: 2025-04-04 08:42:05

Author of last update: Jstuelk

slrR 168

slrR
168