zwf
168

glucose 6-phosphate dehydrogenase, pentose-phosphate pathway

Locus

BSU_23850

Molecular weight

55.49 kDa

Isoelectric point

5.28

Protein length

489 aaSequenceBlast

Gene length

1470 bpSequenceBlast

Function

initiation of the pentose phosphate pathway

Product

glucose 6-phosphate dehydrogenase

Essential

E.C.

1.1.1.49

Synonyms

zwf, yqjJ

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0364 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene

Coordinates

2,479,156 2,480,625

Phenotypes of a mutant

suppresses the growth defect of glmR mutants on gluconeogenic substrates PubMed

a zwf pgi double mutant is unable to grow on minimal medium in the presence of glucose (due to the accumulation of toxic glucose-1-phosphate) PubMed

a zwf pgi pgcA triple mutant is not viable PubMed

The protein

Catalyzed reaction/ biological activity

D-glucose-6-P + NADP⁺ --> D-glucono-1,5-lactone 6-P + H⁺ + NADPH (according to UniProt)

Protein family

glucose-6-phosphate dehydrogenase family (single member, according to UniProt)

Cofactors

Mg2+, Mn2+, Ca2+

Structure

1DPG (PDB) (from Leuconostoc Mesenteroides, 45% identity, 62% similarity) PubMed

P54547 (AlphaFold)

Effectors of protein activity

NAD+, NADP+ and NADPH affect the enzyme kinetic PubMed

Additional information

The enzyme is a dimer PubMed

Expression and Regulation

Operons

Genes

zwf

Description

PubMed

Regulation

constitutive PubMed

Open in new tab

Biological materials

Mutant

MGNA-C392 (yqjJ::erm), available at the NBRP B. subtilis, Japan

SM-NB3 (zwf-spc), available in Anne Galinier's and Boris Görke's labs PubMed

BKE23850 (zwf::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTAAAAGTACCTCACTTT, downstream forward: _UP4_TAATAAGAAGAAAAAAGCCG

BKK23850 (zwf::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTAAAAGTACCTCACTTT, downstream forward: _UP4_TAATAAGAAGAAAAAAGCCG

Expression vectors

pGP2887: expression of Strep-zwf by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab

FLAG-tag construct

GP1401 (spc, based on pGP1331), available in Jörg Stülke's lab

References

Boulanger EF, Sabag-Daigle A, Thirugnanasambantham P, Gopalan V, Ahmer BMMSugar-Phosphate Toxicities.Microbiology and molecular biology reviews : MMBR. 2021 Sep 29; :e0012321. PMID: 34585982

Original Publications

Deng A, Qiu Q, Sun Q, Chen Z, Wang J, Zhang Y, Liu S, Wen TIn silico-guided metabolic engineering of Bacillus subtilis for efficient biosynthesis of purine nucleosides by blocking the key backflow nodes.Biotechnology for biofuels and bioproducts. 2022 Aug 11; 15(1):82. PMID: 35953809

Morabbi Heravi K, Manzoor I, Watzlawick H, de Jong A, Kuipers OP, Altenbuchner J Phosphosugar stress in : Intracellular accumulation of mannose 6-phosphate derepresed the - operon from repression by GlcR. Journal of bacteriology. 2019 Feb 19; . pii:JB.00732-18. doi:10.1128/JB.00732-18. PMID:30782637

Kohlstedt M, Sappa PK, Meyer H, Maaß S, Zaprasis A, Hoffmann T, Becker J, Steil L, Hecker M, van Dijl JM, Lalk M, Mäder U, Stülke J, Bremer E, Völker U, Wittmann C Adaptation of Bacillus subtilis carbon core metabolism to simultaneous nutrient limitation and osmotic challenge: a multi-omics perspective. Environmental microbiology. 2014 Jun; 16(6):1898-917. doi:10.1111/1462-2920.12438. PMID:24571712

Duan YX, Chen T, Chen X, Zhao XM Overexpression of glucose-6-phosphate dehydrogenase enhances riboflavin production in Bacillus subtilis. Applied microbiology and biotechnology. 2010 Feb; 85(6):1907-14. doi:10.1007/s00253-009-2247-6. PMID:19779711

Görke B, Foulquier E, Galinier A YvcK of Bacillus subtilis is required for a normal cell shape and for growth on Krebs cycle intermediates and substrates of the pentose phosphate pathway. Microbiology (Reading, England). 2005 Nov; 151(Pt 11):3777-91. . PMID:16272399

Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135

Rowland P, Basak AK, Gover S, Levy HR, Adams MJ The three-dimensional structure of glucose 6-phosphate dehydrogenase from Leuconostoc mesenteroides refined at 2.0 A resolution. Structure (London, England : 1993). 1994 Nov 15; 2(11):1073-87. . PMID:7881907

Ujita S, Kimura K Glucose-6-phosphate dehydrogenase, vegetative and spore Bacillus subtilis. Methods in enzymology. 1982; 89 Pt D:258-61. . PMID:6292660

Prasad C, Freese E Cell lysis of Bacillus subtilis caused by intracellular accumulation of glucose-1-phosphate. Journal of bacteriology. 1974 Jun; 118(3):1111-22. . PMID:4275311

Page visits: 6277

Time of last update: 2025-04-04 06:29:21

Author of last update: Jstuelk

zwf 168

zwf
168