nrnA

nrnA
168

oligoribonuclease (nanoRNase), 3,5-bisphosphate nucleotidase, degradation of pGpG

Locus
BSU_29250
Molecular weight
34.93 kDa
Isoelectric point
4.67
Protein length
313 aaSequenceBlast
Gene length
942 bpSequenceBlast
Function
processing of short RNA substrates
Product
oligoribonuclease (nanoRNase), 3,5-bisphosphate nucleotidase
Essential
no
E.C.
3.1.3.7
Synonyms
nrnA, ytqI
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0618 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,995,908  2,996,849
Phenotypes of a mutant
The mutant requires cysteine PubMed
strongly reduced genetic competence, competence can be restored by overexpression of comK-comS PubMed
inactivation of nrnA reduces sporulation efficiency to 5% that of wild type cells; delayed entry into sporulation, reduced SigG activity, and production of small forespores PubMed
The protein
Catalyzed reaction/ biological activity
oligoribonuclease (nanoRNAse), 3',5'-bisphosphate nucleotidase PubMed
hydrolyzes oligo(deoxy)ribonucleotides in a 5' 3' direction PubMed
hydrolyzes nano-RNAs in a 3' 5' direction PubMed
degradation of pGpG derived from c-di-GMP PubMed
adenosine 3',5'-bisphosphate + H2O --> AMP + phosphate (according to UniProt)
Protein family
NrnA oligoribonuclease family (single member, according to UniProt)
Domains
DHH-DHHA1 domain PubMed
Cofactors
Mn2+ PubMed
Structure
5J21 (PDB) PubMed
O34600 (AlphaFold)
Localization
Cytoplasm (Homogeneous) PubMed
Expression and Regulation
Operons
Genes
nrnA
Description
PubMed
Open in new tab

nrnA

2025-03-15 20:09:35

ghost

84

39a6f64addb8b628f471fb6331b60617e7e93698

561C540607A61C60D840036C75C966A226C078BB

Biological materials
Mutant
MGNA-A151 (ytqI::erm), available at the NBRP B. subtilis, Japan
GP2155 (ΔnrnA::aphA3), available in Jörg Stülke's lab PubMed
BKE29250 (nrnA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTGATACTCCTTTATTG,  downstream forward: _UP4_GAGTAGAGGGGAGACCCTCT
BKK29250 (nrnA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTGATACTCCTTTATTG,  downstream forward: _UP4_GAGTAGAGGGGAGACCCTCT
References
Reviews
Lee VT, Sondermann H, Winkler WCNano-RNases: oligo- or dinucleases?FEMS microbiology reviews. 2022 Nov 2; 46(6). PMID: 36026528
Bechhofer DH, Deutscher MP Bacterial ribonucleases and their roles in RNA metabolism. Critical reviews in biochemistry and molecular biology. 2019 Jun; 54(3):242-300. doi:10.1080/10409238.2019.1651816. PMID:31464530
Liao H, Liu M, Guo X The special existences: nanoRNA and nanoRNase. Microbiological research. 2018 Mar; 207:134-139. pii:S0944-5013(17)30668-7. doi:10.1016/j.micres.2017.11.014. PMID:29458847
Original Publications
Weiss CA, Myers TM, Wu CH, Jenkins C, Sondermann H, Lee VT, Winkler WCNrnA is a 5'-3' exonuclease that processes short RNA substrates in vivo and in vitro.Nucleic acids research. 2022 Dec 7; 50(21):12369-88. PMID: 36478094
Benda M, Schulz LM, Stülke J, Rismondo JInfluence of the ABC Transporter YtrBCDEF of Bacillus subtilis on Competence, Biofilm Formation and Cell Wall Thickness.Frontiers in microbiology. 2021; 12:587035. PMID: 33897624
Orr MW, Weiss CA, Severin GB, Turdiev H, Kim SK, Turdiev A, Liu K, Tu BP, Waters CM, Winkler WC, Lee VT A subset of exoribonucleases serve as degradative enzymes for pGpG in c-di-GMP signaling. Journal of bacteriology. 2018 Sep 24; . pii:JB.00300-18. doi:10.1128/JB.00300-18. PMID:30249708
Schmier BJ, Nelersa CM, Malhotra A Structural Basis for the Bidirectional Activity of Bacillus nanoRNase NrnA. Scientific reports. 2017 Sep 11; 7(1):11085. doi:10.1038/s41598-017-09403-x. PMID:28894100
Bowman L, Zeden MS, Schuster CF, Kaever V, Gründling A New Insights into the Cyclic Di-adenosine Monophosphate (c-di-AMP) Degradation Pathway and the Requirement of the Cyclic Dinucleotide for Acid Stress Resistance in Staphylococcus aureus. The Journal of biological chemistry. 2016 Dec 30; 291(53):26970-26986. doi:10.1074/jbc.M116.747709. PMID:27834680
Meeske AJ, Rodrigues CD, Brady J, Lim HC, Bernhardt TG, Rudner DZ High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis. PLoS biology. 2016 Jan; 14(1):e1002341. doi:10.1371/journal.pbio.1002341. PMID:26735940
Kuipers K, Gallay C, Martínek V, Rohde M, Martínková M, van der Beek SL, Jong WS, Venselaar H, Zomer A, Bootsma H, Veening JW, de Jonge MI Highly conserved nucleotide phosphatase essential for membrane lipid homeostasis in Streptococcus pneumoniae. Molecular microbiology. 2016 Jul; 101(1):12-26. doi:10.1111/mmi.13312. PMID:26691161
Bai Y, Yang J, Eisele LE, Underwood AJ, Koestler BJ, Waters CM, Metzger DW, Bai G Two DHH subfamily 1 proteins in Streptococcus pneumoniae possess cyclic di-AMP phosphodiesterase activity and affect bacterial growth and virulence. Journal of bacteriology. 2013 Nov; 195(22):5123-32. doi:10.1128/JB.00769-13. PMID:24013631
Nelersa CM, Schmier BJ, Malhotra A Purification and crystallization of Bacillus subtilis NrnA, a novel enzyme involved in nanoRNA degradation. Acta crystallographica. Section F, Structural biology and crystallization communications. 2011 Oct 01; 67(Pt 10):1235-8. doi:10.1107/S1744309111026509. PMID:22102036
Cron LE, Stol K, Burghout P, van Selm S, Simonetti ER, Bootsma HJ, Hermans PW Two DHH subfamily 1 proteins contribute to pneumococcal virulence and confer protection against pneumococcal disease. Infection and immunity. 2011 Sep; 79(9):3697-710. doi:10.1128/IAI.01383-10. PMID:21768284
Wakamatsu T, Kim K, Uemura Y, Nakagawa N, Kuramitsu S, Masui R Role of RecJ-like protein with 5'-3' exonuclease activity in oligo(deoxy)nucleotide degradation. The Journal of biological chemistry. 2011 Jan 28; 286(4):2807-16. doi:10.1074/jbc.M110.161596. PMID:21087930
Fang M, Zeisberg WM, Condon C, Ogryzko V, Danchin A, Mechold U Degradation of nanoRNA is performed by multiple redundant RNases in Bacillus subtilis. Nucleic acids research. 2009 Aug; 37(15):5114-25. doi:10.1093/nar/gkp527. PMID:19553197
Zhang J, Biswas I 3'-Phosphoadenosine-5'-phosphate phosphatase activity is required for superoxide stress tolerance in Streptococcus mutans. Journal of bacteriology. 2009 Jul; 191(13):4330-40. doi:10.1128/JB.00184-09. PMID:19429620
Mechold U, Fang G, Ngo S, Ogryzko V, Danchin A YtqI from Bacillus subtilis has both oligoribonuclease and pAp-phosphatase activity. Nucleic acids research. 2007; 35(13):4552-61. . PMID:17586819
Meile JC, Wu LJ, Ehrlich SD, Errington J, Noirot P Systematic localisation of proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new proteins at the DNA replication factory. Proteomics. 2006 Apr; 6(7):2135-46. . PMID:16479537
Lapidus A, Galleron N, Sorokin A, Ehrlich SD Sequencing and functional annotation of the Bacillus subtilis genes in the 200 kb rrnB-dnaB region. Microbiology (Reading, England). 1997 Nov; 143 ( Pt 11):3431-41. . PMID:9387221

4C630B61249F8F2369E9BFE8A49885D3225DE7B6

Page visits: 4249

Time of last update: 2025-04-10 19:31:59

Author of last update: Jstuelk