purR

purR
168

transcription repressor of the pur operon

Locus
BSU_00470
Molecular weight
31.08 kDa
Isoelectric point
5.77
Protein length
Gene length
Function
regulation of purine biosynthesis
Product
transcription repressor of the pur operon
Essential
no
Synonyms
purR, yabI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0503 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
54,441  55,298
The protein
Protein family
N-terminal winged helix-turn-helix domain PubMed
C-terminal effector binding domain PubMed
Structure
1O57 (PDB) (the apo-protein) PubMed
7RMW (PDB) (complex with ppGpp) PubMed
Effectors of protein activity
PRPP acts as inducer, binding results in release of PurR from the operator PubMed
(p)ppGpp acts as an anti-inducer, prevents binding of the inducer PRPP PubMed
Kinetic information
KD for ppGpp: 4.4 µM PubMed
Expression and Regulation
Operons
Description
Regulation
negative autoregulation PubMed
Regulatory mechanism
PurR: repression, PubMed, in purR regulon
Open in new tab

ispEyabJ

2025-03-31 01:13:41

Jstuelk

115

620be59868c14a2ea15f75e6fdf1022628ca65bb

B42ADE39EB92F53783BD0BDEF129E37859FEBF47

Biological materials
Mutant
BKE00470 (purR::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATGAACTCACCCCCAAAAT,  downstream forward: _UP4_TTAAAGAATGGAGAGACAGA
BKK00470 (purR::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATGAACTCACCCCCAAAAT,  downstream forward: _UP4_TTAAAGAATGGAGAGACAGA
References
Reviews
Hove-Jensen B, Andersen KR, Kilstrup M, Martinussen J, Switzer RL, Willemoës M Phosphoribosyl Diphosphate (PRPP): Biosynthesis, Enzymology, Utilization, and Metabolic Significance. Microbiology and molecular biology reviews : MMBR. 2017 Mar; 81(1). pii:e00040-16. doi:10.1128/MMBR.00040-16. PMID:28031352
Original Publications
Anderson BW, Schumacher MA, Yang J, Turdiev A, Turdiev H, Schroeder JW, He Q, Lee VT, Brennan RG, Wang JDThe nucleotide messenger (p)ppGpp is an anti-inducer of the purine synthesis transcription regulator PurR in Bacillus.Nucleic acids research. 2021 Dec 30; . PMID: 34967415
Shi S, Chen T, Zhang Z, Chen X, Zhao X Transcriptome analysis guided metabolic engineering of Bacillus subtilis for riboflavin production. Metabolic engineering.; 11(4-5):243-52. doi:10.1016/j.ymben.2009.05.002. PMID:19446032
Nygaard P, Saxild HH The purine efflux pump PbuE in Bacillus subtilis modulates expression of the PurR and G-box (XptR) regulons by adjusting the purine base pool size. Journal of bacteriology. 2005 Jan; 187(2):791-4. . PMID:15629952
Rappu P, Pullinen T, Mäntsälä P In vivo effect of mutations at the PRPP binding site of the Bacillus subtilis purine repressor. Journal of bacteriology. 2003 Nov; 185(22):6728-31. . PMID:14594850
Bera AK, Zhu J, Zalkin H, Smith JL Functional dissection of the Bacillus subtilis pur operator site. Journal of bacteriology. 2003 Jul; 185(14):4099-109. . PMID:12837784
Sinha SC, Krahn J, Shin BS, Tomchick DR, Zalkin H, Smith JL The purine repressor of Bacillus subtilis: a novel combination of domains adapted for transcription regulation. Journal of bacteriology. 2003 Jul; 185(14):4087-98. . PMID:12837783
Saxild HH, Brunstedt K, Nielsen KI, Jarmer H, Nygaard P Definition of the Bacillus subtilis PurR operator using genetic and bioinformatic tools and expansion of the PurR regulon with glyA, guaC, pbuG, xpt-pbuX, yqhZ-folD, and pbuO. Journal of bacteriology. 2001 Nov; 183(21):6175-83. . PMID:11591660
Weng M, Zalkin H Mutations in the Bacillus subtilis purine repressor that perturb PRPP effector function in vitro and in vivo. Current microbiology. 2000 Jul; 41(1):56-9. . PMID:10919400
Rappu P, Shin BS, Zalkin H, Mäntsälä P A role for a highly conserved protein of unknown function in regulation of Bacillus subtilis purA by the purine repressor. Journal of bacteriology. 1999 Jun; 181(12):3810-5. . PMID:10368157
Weng M, Nagy PL, Zalkin H Identification of the Bacillus subtilis pur operon repressor. Proceedings of the National Academy of Sciences of the United States of America. 1995 Aug 01; 92(16):7455-9. . PMID:7638212

A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C

Page visits: 5770

Time of last update: 2025-04-06 13:49:27

Author of last update: Jstuelk