gapB

gapB
168

glyceraldehyde-3-phosphate dehydrogenase, NADP-dependent, gluconeogenic enzyme, forms a transhydrogenation cycle with GapA for balancing of NADPH

Locus
BSU_29020
Molecular weight
37.32 kDa
Isoelectric point
6.45
Protein length
340 aaSequenceBlast
Gene length
1023 bpSequenceBlast
Function
anabolic enzyme in gluconeogenesis
Product
glyceraldehyde-3-phosphate dehydrogenase 2
Essential
no
E.C.
1.2.1.59
Synonyms
gapB
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0057 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,967,032 → 2,968,054
Phenotypes of a mutant
inactivation of ''gapB'' reduces sporulation efficiency to 0.3% that of wild type cells; delayed entry into sporulation and fewer sporulating cells PubMed
The protein
Catalyzed reaction/ biological activity
D-glyceraldehyde3-P + NADP+ + phosphate --> 1,3-bisphosphoglycerate + H+ + NADPH(according to UniProt)
This reaction is part of the gluconeogenesis
Protein family
glyceraldehyde-3-phosphate dehydrogenase family (with GapA, according to UniProt)
Domains
Nucleotid bindinge domain (12-13)
2x glyceraldehyde-3-P binding domain (151-153) & (210-211)
Cofactors
NADP+ (preferentially) and NAD+ PubMed
Structure
3PRL (PDB) (from B. halodurans)
O34425 (AlphaFold)
Kinetic information
Michaelis-Menten PubMed
Paralogous protein(s)
GapA
Localization
Cytoplasm (Homogeneous) PubMed
Additional information
aggregates at elevated temperatures, aggregation is prevented by interaction with YjoB PubMed
Expression and Regulation
Operons
Genes
gapB-speD
Description
PubMed
Regulation
gapB: repressed in the presence of glucose (CcpN) PubMed
Regulatory mechanism
CcpN: repression, PubMed, in ccpN regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
speD: the mRNA is substantially stabilized upon depletion of RNase Y (the half-life of the monocistronic speD mRNA increases from 1.4 to 36 min) PubMed
Open in new tab

gapB→speD

2025-03-27 02:12:40

Jstuelk

105

FD19E158AAF06F7ED8F02CFEE19CA4A6483E5FCD

2E200F04B473223099E032055E071DE51C38D7C2

Biological materials
Mutant
MGNA-A121 (gapB::erm), available at the NBRP B. subtilis, Japan
GP701 (gapB::spec), available in Stülke lab
1A1004 ( gapB::erm), PubMed, available at BGSC
BKE29020 (ΔgapB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTGGACACCCCTTATC,  downstream forward: _UP4_TAAAATAAGGTCATGGACAC
BKK29020 (ΔgapB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTGGACACCCCTTATC,  downstream forward: _UP4_TAAAATAAGGTCATGGACAC
LacZ fusion
pGP3312 (pgapB-lacZ cat), GP1679, available in Jörg Stülke's lab
Labs working on this gene/protein
Stephane Aymerich, Microbiology and Molecular Genetics, INRA Paris-Grignon, France
References
Kwon E, Dahal P, Kim DYCrystal structure and biochemical analysis suggest that YjoB ATPase is a putative substrate-specific molecular chaperone.Proceedings of the National Academy of Sciences of the United States of America. 2022 Oct 11; 119(41):e2207856119. PMID: 36191235
Gerth U, Krieger E, Zühlke D, Reder A, Völker U, Hecker M Stability of proteins out of service - The GapB case of Bacillus subtilis. Journal of bacteriology. 2017 Jul 31; . pii:JB.00148-17. doi:10.1128/JB.00148-17. PMID:28760849
Meeske AJ, Rodrigues CD, Brady J, Lim HC, Bernhardt TG, Rudner DZ High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis. PLoS biology. 2016 Jan; 14(1):e1002341. doi:10.1371/journal.pbio.1002341. PMID:26735940
de Jong IG, Veening JW, Kuipers OP Single cell analysis of gene expression patterns during carbon starvation in Bacillus subtilis reveals large phenotypic variation. Environmental microbiology. 2012 Dec; 14(12):3110-21. doi:10.1111/j.1462-2920.2012.02892.x. PMID:23033921
Rühl M, Le Coq D, Aymerich S, Sauer U 13C-flux analysis reveals NADPH-balancing transhydrogenation cycles in stationary phase of nitrogen-starving Bacillus subtilis. The Journal of biological chemistry. 2012 Aug 10; 287(33):27959-70. doi:10.1074/jbc.M112.366492. PMID:22740702
Ferguson ML, Le Coq D, Jules M, Aymerich S, Radulescu O, Declerck N, Royer CA Reconciling molecular regulatory mechanisms with noise patterns of bacterial metabolic promoters in induced and repressed states. Proceedings of the National Academy of Sciences of the United States of America. 2012 Jan 03; 109(1):155-60. doi:10.1073/pnas.1110541108. PMID:22190493
Tännler S, Fischer E, Le Coq D, Doan T, Jamet E, Sauer U, Aymerich S CcpN controls central carbon fluxes in Bacillus subtilis. Journal of bacteriology. 2008 Sep; 190(18):6178-87. doi:10.1128/JB.00552-08. PMID:18586936
Thomaides HB, Davison EJ, Burston L, Johnson H, Brown DR, Hunt AC, Errington J, Czaplewski L Essential bacterial functions encoded by gene pairs. Journal of bacteriology. 2007 Jan; 189(2):591-602. . PMID:17114254
Meile JC, Wu LJ, Ehrlich SD, Errington J, Noirot P Systematic localisation of proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new proteins at the DNA replication factory. Proteomics. 2006 Apr; 6(7):2135-46. . PMID:16479537
Servant P, Le Coq D, Aymerich S CcpN (YqzB), a novel regulator for CcpA-independent catabolite repression of Bacillus subtilis gluconeogenic genes. Molecular microbiology. 2005 Mar; 55(5):1435-51. . PMID:15720552
Sekowska A, Coppée JY, Le Caer JP, Martin-Verstraete I, Danchin A S-adenosylmethionine decarboxylase of Bacillus subtilis is closely related to archaebacterial counterparts. Molecular microbiology. 2000 Jun; 36(5):1135-47. . PMID:10844697
Fillinger S, Boschi-Muller S, Azza S, Dervyn E, Branlant G, Aymerich S Two glyceraldehyde-3-phosphate dehydrogenases with opposite physiological roles in a nonphotosynthetic bacterium. The Journal of biological chemistry. 2000 May 12; 275(19):14031-7. . PMID:10799476

C1B89BD3DD27CD566018558D3A7845FB451056F0

Page visits: 8401

Time of last update: 2025-04-06 16:05:55

Author of last update: Jstuelk