sbcD

sbcD
168

exonuclease SbcD homolog

Locus
BSU_10640
Molecular weight
43.25 kDa
Isoelectric point
5
Protein length
Gene length
Function
unknown
Product
exonuclease SbcD homolog
Essential
no
Synonyms
sbcD, yixA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0420 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,143,577  1,144,752
Phenotypes of a mutant
reduced resistance towards electron beams PubMed
reduced formation of rpsB or rpsE suppressor mutants after mitomycin treatment PubMed
The protein
Protein family
sbcD family (single member, according to UniProt)
Structure
4LTY (PDB) (from E. coli, corresponds to aa 1 - 314 of SbcD, 30% identity) PubMed
Cytoplasm (Homogeneous) PubMed
Expression and Regulation
Operons
Description
Regulation
positive control by ComK PubMed
Regulatory mechanism
ComK: activation, in comK regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

addBhlpB

2025-04-03 20:37:41

ghost

169

045c7bb396e5f5521fcc2041130afbaac29b0bd8

E5051999C31DBE142375FC331C2F21A76C29910D

Biological materials
Mutant
GP894 (sbcD-sbcC::kan), available in Jörg Stülke's lab PubMed
BKE10640 (sbcD::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CAAATGCTTTCACCTCTCTT,  downstream forward: _UP4_GGCGTTGAAGAGGAGGATGC
BKK10640 (sbcD::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CAAATGCTTTCACCTCTCTT,  downstream forward: _UP4_GGCGTTGAAGAGGAGGATGC
References
Korry BJ, Lee SYE, Chakrabarti AK, Choi AH, Ganser C, Machan JT, Belenky PGenotoxic Agents Produce Stressor-specific Spectra of Spectinomycin Resistance Mutations based on Mechanism of Action and Selection in Bacillus subtilis.Antimicrobial agents and chemotherapy. 2021 Aug 2; :AAC0089121. PMID: 34339280
Zhang Y, Huber N, Moeller R, Stülke J, Dubovcova B, Akepsimaidis G, Meneses N, Drissner D, Mathys A Role of DNA repair in Bacillus subtilis spore resistance to high energy and low energy electron beam treatments. Food microbiology. 2020 May; 87:103353. pii:S0740-0020(19)30963-3. doi:10.1016/j.fm.2019.103353. PMID:31948638
Saathoff JH, Käshammer L, Lammens K, Byrne RT, Hopfner KP The bacterial Mre11-Rad50 homolog SbcCD cleaves opposing strands of DNA by two chemically distinct nuclease reactions. Nucleic acids research. 2018 Oct 02; . doi:10.1093/nar/gky878. PMID:30277537
Liu S, Tian LF, Liu YP, An XM, Tang Q, Yan XX, Liang DC Structural basis for DNA recognition and nuclease processing by the Mre11 homologue SbcD in double-strand breaks repair. Acta crystallographica. Section D, Biological crystallography. 2014 Feb; 70(Pt 2):299-309. doi:10.1107/S139900471302693X. PMID:24531464
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Meile JC, Wu LJ, Ehrlich SD, Errington J, Noirot P Systematic localisation of proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new proteins at the DNA replication factory. Proteomics. 2006 Apr; 6(7):2135-46. . PMID:16479537
Ogura M, Yamaguchi H, Kobayashi K, Ogasawara N, Fujita Y, Tanaka T Whole-genome analysis of genes regulated by the Bacillus subtilis competence transcription factor ComK. Journal of bacteriology. 2002 May; 184(9):2344-51. . PMID:11948146
Sharples GJ, Lloyd RG Location of the Bacillus subtilis sbcD gene downstream of addAB, the analogues of E. coli recBC. Nucleic acids research. 1993 Apr 25; 21(8):2010. . PMID:8493111

4D89BFFB1073407A7A1762AFD18B49F3414D6787

Page visits: 4010

Time of last update: 2025-04-13 03:46:37

Author of last update: Jstuelk