qdoI

qdoI
168

Fe-containing quercetin 2,3-dioxygenase

Locus
BSU_39980
Molecular weight
37.43 kDa
Isoelectric point
5.56
Protein length
337 aaSequenceBlast
Gene length
1014 bpSequenceBlast
Function
resistance to plant product quercetin
Product
Fe-containing quercetin 2,3-dioxygenase
Essential
no
Synonyms
qdoI, yxaG
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1917 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,106,245  4,107,258
The protein
Catalyzed reaction/ biological activity
oxidation of the flavonol quercetin with dioxygen, cleaving the central heterocyclic ring and releasing CO
O2 + quercetin --> 2-(3,4-dihydroxybenzoyloxy)-4,6-dihydroxybenzoate + CO (according to UniProt)
Protein family
bicupin family
Domains
2 cupin 2 domains (aa 55 ... 110, aa 226 ... 281)
Cofactors
Mn(II) (preferred), but also active with Fe(II) snd Co(II) PubMed
Structure
1Y3T (PDB) PubMed
2H0V (PDB)
P42106 (AlphaFold)
Expression and Regulation
Operons
Genes
qdoI-yxaH
Description
PubMed
Regulation
induced by flavonoids such as quercetin (QdoR, LmrA) PubMed
Regulatory mechanism
LmrA: repression, PubMed, in lmrA regulon
QdoR: repression, PubMed, in qdoR regulon
Additional information
major regulator: QdoR PubMed
Open in new tab

qdoI→yxaH

2025-03-12 23:00:43

ghost

71

c14e762fec9f4cbec17fdbace8ff20295b9c49d0

C80841584C27E4DC50FE3CA20B59B16E53149C1B

Biological materials
Mutant
MGNA-B684 (yxaG::erm), available at the NBRP B. subtilis, Japan
BKE39980 (qdoI::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATTATCGCTTCCTCCAA,  downstream forward: _UP4_TAAAGATGACAAGATTGTAA
BKK39980 (qdoI::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATTATCGCTTCCTCCAA,  downstream forward: _UP4_TAAAGATGACAAGATTGTAA
References
Reviews
Broderick JB Catechol dioxygenases. Essays in biochemistry. 1999; 34:173-89. . PMID:10730195
Bugg TD, Sanvoisin J, Spence EL Exploring the catalytic mechanism of the extradiol catechol dioxygenases. Biochemical Society transactions. 1997 Feb; 25(1):81-5. . PMID:9056848
Original Publications
Wojdyła Z, Borowski T DFT study of the mechanism of manganese quercetin 2,3-dioxygenase: quest for origins of enzyme unique nitroxygenase activity and regioselectivity. Journal of biological inorganic chemistry : JBIC : a publication of the Society of Biological Inorganic Chemistry. 2016 Jul; 21(4):475-89. doi:10.1007/s00775-016-1356-9. PMID:27170159
Kumar MR, Zapata A, Ramirez AJ, Bowen SK, Francisco WA, Farmer PJ Nitrosyl hydride (HNO) replaces dioxygen in nitroxygenase activity of manganese quercetin dioxygenase. Proceedings of the National Academy of Sciences of the United States of America. 2011 Nov 22; 108(47):18926-31. doi:10.1073/pnas.1111488108. PMID:22084064
Hirooka K, Fujita Y Excess production of Bacillus subtilis quercetin 2,3-dioxygenase affects cell viability in the presence of quercetin. Bioscience, biotechnology, and biochemistry. 2010; 74(5):1030-8. . PMID:20460727
Hirooka K, Kunikane S, Matsuoka H, Yoshida K, Kumamoto K, Tojo S, Fujita Y Dual regulation of the Bacillus subtilis regulon comprising the lmrAB and yxaGH operons and yxaF gene by two transcriptional repressors, LmrA and YxaF, in response to flavonoids. Journal of bacteriology. 2007 Jul; 189(14):5170-82. . PMID:17483215
Schaab MR, Barney BM, Francisco WA Kinetic and spectroscopic studies on the quercetin 2,3-dioxygenase from Bacillus subtilis. Biochemistry. 2006 Jan 24; 45(3):1009-16. . PMID:16411777
Gopal B, Madan LL, Betz SF, Kossiakoff AA The crystal structure of a quercetin 2,3-dioxygenase from Bacillus subtilis suggests modulation of enzyme activity by a change in the metal ion at the active site(s). Biochemistry. 2005 Jan 11; 44(1):193-201. . PMID:15628860
Yoshida K, Ohki YH, Murata M, Kinehara M, Matsuoka H, Satomura T, Ohki R, Kumano M, Yamane K, Fujita Y Bacillus subtilis LmrA is a repressor of the lmrAB and yxaGH operons: identification of its binding site and functional analysis of lmrB and yxaGH. Journal of bacteriology. 2004 Sep; 186(17):5640-8. . PMID:15317768
Barney BM, Schaab MR, LoBrutto R, Francisco WA Evidence for a new metal in a known active site: purification and characterization of an iron-containing quercetin 2,3-dioxygenase from Bacillus subtilis. Protein expression and purification. 2004 May; 35(1):131-41. . PMID:15039076
Bowater L, Fairhurst SA, Just VJ, Bornemann S Bacillus subtilis YxaG is a novel Fe-containing quercetin 2,3-dioxygenase. FEBS letters. 2004 Jan 16; 557(1-3):45-8. . PMID:14741339
Dunwell JM, Purvis A, Khuri S Cupins: the most functionally diverse protein superfamily? Phytochemistry. 2004 Jan; 65(1):7-17. . PMID:14697267
Yoshida K, Ishio I, Nagakawa E, Yamamoto Y, Yamamoto M, Fujita Y Systematic study of gene expression and transcription organization in the gntZ-ywaA region of the Bacillus subtilis genome. Microbiology (Reading, England). 2000 Mar; 146 ( Pt 3):573-9. . PMID:10746760

6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A

Page visits: 3117

Time of last update: 2025-04-06 03:42:42

Author of last update: Melvin.boenninger