gamP
168

glucosamine-specific permease of the phosphotransferase system, EIICBA of the PTS

Locus

BSU_02350

Molecular weight

67.97 kDa

Isoelectric point

5.47

Protein length

631 aaSequenceBlast

Gene length

1896 bpSequenceBlast

Function

glucosamine uptake and phosphorylation

Product

glucosamine-specific PTS, EIICBA

Essential

E.C.

2.7.1.69

Synonyms

gamP, ybfS, yzfA

Outlinks

BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2190 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene

Coordinates

254,907 256,802

Phenotypes of a mutant

delayed growth with glucosamine as the single carbon source PubMed

The protein

Catalyzed reaction/ biological activity

protein EIIA N^pi-phospho-L-histidine + protein EIIB --> protein EIIA + protein EIIB N^pi-phospho-L-histidine/cysteine (according to UniProt)

Protein family

PTS permease, glucose family PubMed

Domains

PTS EIIA domain type-1 (aa 515-619) (according to UniProt)

PTS EIIB domain type-1 (aa 397-478) (according to UniProt)

PTS EIIC domain type-1 (aa 1-382) (according to UniProt)

Structure

6BVG (PDB) (EIIC domain from B. cereus, corresponds to aa 5 ... 380), 32.5% identity PubMed

3BP3 (PDB) (EIIB domain from E. coli, corresponds to aa 403 ... 467), 56.9% identity PubMed

1AX3 (PDB) (EIIA domain of PtsG, corresponds to aa 489 ... 622), 55.6% identity PubMed

P39816 (AlphaFold)

Paralogous protein(s)

NagP, PtsG, MalP

Localization

membrane PubMed

Expression and Regulation

Operons

Genes

gamA-gamP

Description

PubMed

Regulation

induced by glucosamine (GamR) PubMed

Regulatory mechanism

GamR: repression, PubMed, in gamR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Open in new tab

Biological materials

Mutant

MGNA-B937 (ybfS::erm), available at the NBRP B. subtilis, Japan

QB6098 (aphA3), available in Jörg Stülke's lab

BKE02350 (gamP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGACAGTCTCCTTTTATT, downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTG

BKK02350 (gamP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGACAGTCTCCTTTTATT, downstream forward: _UP4_TAAAAAAGTCCCCCCTGCTG

References

Reviews

Gilmore MC, Cava FBacterial peptidoglycan recycling.Trends in microbiology. 2024 Nov 28; . PMID: 39613687

Original Publications

O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589

Morabbi Heravi K, Altenbuchner J Cross-talk among transporters of the phosphoenolpyruvate-dependent phosphotransferase system in . Journal of bacteriology. 2018 Jul 23; . pii:JB.00213-18. doi:10.1128/JB.00213-18. PMID:30038046

Ren Z, Lee J, Moosa MM, Nian Y, Hu L, Xu Z, McCoy JG, Ferreon ACM, Im W, Zhou M Structure of an EIIC sugar transporter trapped in an inward-facing conformation. Proceedings of the National Academy of Sciences of the United States of America. 2018 Jun 05; 115(23):5962-5967. doi:10.1073/pnas.1800647115. PMID:29784777

Gaugué I, Oberto J, Putzer H, Plumbridge J The use of amino sugars by Bacillus subtilis: presence of a unique operon for the catabolism of glucosamine. PloS one. 2013; 8(5):e63025. doi:10.1371/journal.pone.0063025. PMID:23667565

Hahne H, Wolff S, Hecker M, Becher D From complementarity to comprehensiveness--targeting the membrane proteome of growing Bacillus subtilis by divergent approaches. Proteomics. 2008 Oct; 8(19):4123-36. doi:10.1002/pmic.200800258. PMID:18763711

Nam TW, Jung HI, An YJ, Park YH, Lee SH, Seok YJ, Cha SS Analyses of Mlc-IIBGlc interaction and a plausible molecular mechanism of Mlc inactivation by membrane sequestration. Proceedings of the National Academy of Sciences of the United States of America. 2008 Mar 11; 105(10):3751-6. doi:10.1073/pnas.0709295105. PMID:18319344

Reizer J, Bachem S, Reizer A, Arnaud M, Saier MH, Stülke J Novel phosphotransferase system genes revealed by genome analysis - the complete complement of PTS proteins encoded within the genome of Bacillus subtilis. Microbiology (Reading, England). 1999 Dec; 145 ( Pt 12):3419-29. . PMID:10627040

Chen Y, Case DA, Reizer J, Saier MH, Wright PE High-resolution solution structure of Bacillus subtilis IIAglc. Proteins. 1998 May 15; 31(3):258-70. . PMID:9593197

Larder BA, Darby G, Richman DDHIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy.Science (New York, N.Y.). 1989 Mar 31; 243(4899):1731-4. PMID: 2467383

Page visits: 5641

Time of last update: 2025-04-06 09:29:46

Author of last update: Jstuelk

gamP 168

gamP
168