capB

capB
168

part of the CapB-CapC glutamic acid ligase, capsular polyglutamate biosynthesis

Locus
BSU_35900
Molecular weight
43.79 kDa
Isoelectric point
5.07
Protein length
393 aaSequenceBlast
Gene length
1182 bpSequenceBlast
Function
capsule synthesis
Product
poly-gamma-glutamate synthetase
Essential
no
Synonyms
capB, ywsC, pgsB
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0771 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,699,446  3,700,627
Phenotypes of a mutant
no synthesis of the poly-gamma-glutamate capsule PubMed
The protein
Catalyzed reaction/ biological activity
synthesis of poly-gamma-glutamate from L-Glu PubMed
Structure
P96736 (AlphaFold)
Expression and Regulation
Operons
Genes
capB-capC-capA-capE
Description
PubMed
Regulatory mechanism
DegU: activation, DegU-P, PubMed, in degU regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
expression of the operon is increased in 'motA' or 'motB' mutants due to increased DegU phosphorylation PubMed
Open in new tab

capB→capE

2025-03-16 08:50:33

ghost

109

bf6b0bf03353d832d0fb99e09c0c2fcd8af8f057

1302D3190C59C849B9803B3A11C008FA08B67E54

Biological materials
Mutant
MGNA-B262 (ywsC::erm), available at the NBRP B. subtilis, Japan
BKE35900 (capB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGCTTTTCGACATCTCC,  downstream forward: _UP4_GTAAGCTAGGGGGAAATGCA
BKK35900 (capB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGCTTTTCGACATCTCC,  downstream forward: _UP4_GTAAGCTAGGGGGAAATGCA
References
Reviews
Hsueh YH, Huang KY, Kunene SC, Lee TY Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation. International journal of molecular sciences. 2017 Dec 07; 18(12). pii:E2644. doi:10.3390/ijms18122644. PMID:29215550
Marvasi M, Visscher PT, Casillas Martinez L Exopolymeric substances (EPS) from Bacillus subtilis: polymers and genes encoding their synthesis. FEMS microbiology letters. 2010 Dec; 313(1):1-9. doi:10.1111/j.1574-6968.2010.02085.x. PMID:20735481
Candela T, Fouet A Poly-gamma-glutamate in bacteria. Molecular microbiology. 2006 Jun; 60(5):1091-8. . PMID:16689787
Original Publications
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Liu CL, Dong HG, Xue K, Yang W, Liu P, Cai D, Liu X, Yang Y, Bai Z Biosynthesis of poly-γ-glutamic acid in E. coli by heterologous expression of pgsBCAE operon from Bacillus. Journal of applied microbiology. 2019 Dec 13; . doi:10.1111/jam.14552. PMID:31837088
Tiwari DP, Chatterjee PM, Rotti H, Chand B, Raval R, Dubey AK Expression dynamics of the poly-γ-glutamic acid biosynthesis genes of Bacillus subtilis in response to glucose and glutamic acid-A pilot study. FEMS microbiology letters. 2018 Oct 05; . doi:10.1093/femsle/fny248. PMID:30295732
Sawada K, Araki H, Takimura Y, Masuda K, Kageyama Y, Ozaki K, Hagihara H Poly-L-gamma-glutamic acid production by recombinant Bacillus subtilis without pgsA gene. AMB Express. 2018 Jul 03; 8(1):110. doi:10.1186/s13568-018-0636-x. PMID:29971620
Lin B, Li Z, Zhang H, Wu J, Luo M Cloning and Expression of the γ-Polyglutamic Acid Synthetase Gene pgsBCA in Bacillus subtilis WB600. BioMed research international. 2016; 2016:3073949. doi:10.1155/2016/3073949. PMID:27073802
Chan JM, Guttenplan SB, Kearns DB Defects in the flagellar motor increase synthesis of poly-γ-glutamate in Bacillus subtilis. Journal of bacteriology. 2014 Feb; 196(4):740-53. doi:10.1128/JB.01217-13. PMID:24296669
Do TH, Suzuki Y, Abe N, Kaneko J, Itoh Y, Kimura K Mutations suppressing the loss of DegQ function in Bacillus subtilis (natto) poly-γ-glutamate synthesis. Applied and environmental microbiology. 2011 Dec; 77(23):8249-58. doi:10.1128/AEM.05827-11. PMID:21965392
Kamei T, Yamashiro D, Horiuchii T, Minouchi Y, Ashiuchi M Identification and biochemical characterization of membranous short-chain polyglutamate from Bacillus subtilis. Chemistry & biodiversity. 2010 Jun; 7(6):1563-72. doi:10.1002/cbdv.200900238. PMID:20564574
Yeh CM, Wang JP, Lo SC, Chan WC, Lin MY Chromosomal integration of a synthetic expression control sequence achieves poly-gamma-glutamate production in a Bacillus subtilis strain. Biotechnology progress.; 26(4):1001-7. doi:10.1002/btpr.417. PMID:20564357
Ohsawa T, Tsukahara K, Ogura M Bacillus subtilis response regulator DegU is a direct activator of pgsB transcription involved in gamma-poly-glutamic acid synthesis. Bioscience, biotechnology, and biochemistry. 2009 Sep; 73(9):2096-102. . PMID:19734658
Kimura K, Tran LS, Do TH, Itoh Y Expression of the pgsB encoding the poly-gamma-DL-glutamate synthetase of Bacillus subtilis (natto). Bioscience, biotechnology, and biochemistry. 2009 May; 73(5):1149-55. . PMID:19420703
Osera C, Amati G, Calvio C, Galizzi A SwrAA activates poly-gamma-glutamate synthesis in addition to swarming in Bacillus subtilis. Microbiology (Reading, England). 2009 Jul; 155(Pt 7):2282-7. doi:10.1099/mic.0.026435-0. PMID:19389763
Sung MH, Park C, Kim CJ, Poo H, Soda K, Ashiuchi M Natural and edible biopolymer poly-gamma-glutamic acid: synthesis, production, and applications. Chemical record (New York, N.Y.). 2005; 5(6):352-66. . PMID:16278834
Urushibata Y, Tokuyama S, Tahara Y Difference in transcription levels of cap genes for gamma-polyglutamic acid production between Bacillus subtilis IFO 16449 and Marburg 168. Journal of bioscience and bioengineering. 2002; 93(2):252-4. . PMID:16233197
Urushibata Y, Tokuyama S, Tahara Y Characterization of the Bacillus subtilis ywsC gene, involved in gamma-polyglutamic acid production. Journal of bacteriology. 2002 Jan; 184(2):337-43. . PMID:11751809

86C05126ADBA22BB1771B1FA3D214B2E7A36311E

Page visits: 5989

Time of last update: 2025-04-10 14:32:31

Author of last update: Jstuelk