pbpA

pbpA
168

class B penicillin-binding protein PBP 2A, required for cell wall synthesis during cell elongation, works together with RodA in the elongasome for lateral cell wall synthesis and control of cell diameter

Locus
BSU_25000
Molecular weight
79.96 kDa
Isoelectric point
9.57
Protein length
716 aaSequenceBlast
Gene length
2151 bpSequenceBlast
Function
formation of a rod-shaped peptidoglycan cell wall, spore outgrowth
Product
penicillin-binding protein PBP 2A
Essential
no
Synonyms
pbpA, yqgF
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0768 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,581,771  2,583,921
Phenotypes of a mutant
a pbpA pbpH double mutant is not viable PubMed
The protein
Catalyzed reaction/ biological activity
required for cell wall synthesis during cell elongation PubMed
driver of MreB dynamics PubMed
transpeptidase activity PubMed
Protein family
transpeptidase family (according to UniProt)
Structure
3VSK (PDB) (from Staphylococcus aureus, 45% identity) PubMed
P54488 (AlphaFold)
Paralogous protein(s)
PbpH
Localization
extracellular (signal peptide) PubMed
during vegetative growth: evenly distributed along the membrane PubMed
localization depends on the availability of peptidoglyan precursors (lipid II) PubMed
Expression and Regulation
Operons
Genes
pbpA
Description
PubMed
Additional information
the mRNA is substantially stabilized upon depletion of RNase Y PubMed
Open in new tab

pbpA

2025-03-21 03:40:28

ghost

98

9281f9b691db7f23f85efdefe838c9c794c501cf

6BC0F86B6B409DBC0C3E82261C20F656BBA6D28C

Biological materials
Mutant
MGNA-C461 (yqgF::erm), available at the NBRP B. subtilis, Japan
BKE25000 (pbpA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAACATCACCTTTTCTAT,  downstream forward: _UP4_TAAAAAAAAACGCTCACATG
BKK25000 (pbpA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAACATCACCTTTTCTAT,  downstream forward: _UP4_TAAAAAAAAACGCTCACATG
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jeff Errington lab
GFP fusion
3103  trpC2 pbpA::pSG5043 (cat Pxyl-gfpa-pbpA1-804) PubMed, available in Dirk Jan Scheffers' lab and in the BGSC
Labs working on this gene/protein
Jeff Errington, Newcastle University, UK homepage
Original Publications
Stuckenschneider L, Graumann PLLocalization and Single Molecule Dynamics of Bacillus subtilis Penicillin-Binding Proteins Depend on Substrate Availability and Are Affected by Stress Conditions.Cells. 2025 Mar 13; 14(6). PMID: 40136678
Middlemiss S, Blandenet M, Roberts DM, McMahon A, Grimshaw J, Edwards JM, Sun Z, Whitley KD, Blu T, Strahl H, Holden SMolecular motor tug-of-war regulates elongasome cell wall synthesis dynamics in Bacillus subtilis.Nature communications. 2024 Jun 26; 15(1):5411. PMID: 38926336
Mitchell SL, Kearns DB, Carlson EEPenicillin-binding protein redundancy in Bacillus subtilis enables growth during alkaline shock.Applied and environmental microbiology. 2023 Dec 21; :e0054823. PMID: 38126750
Mitchell SL, Kearns DB, Carlson EEPenicillin-binding protein redundancy in Bacillus subtilis enables growth during alkaline shock.bioRxiv : the preprint server for biology. 2023 Mar 20; . PMID: 36993441
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Delisle J, Cordier B, Audebert S, Pophillat M, Cluzel C, Espinosa L, Grangeasse C, Galinier A, Doan TCharacterization of TseB: A new actor in cell wall elongation in Bacillus subtilis.Molecular microbiology. 2021 Aug 19; . PMID: 34411374
Sjodt M, Rohs PDA, Gilman MSA, Erlandson SC, Zheng S, Green AG, Brock KP, Taguchi A, Kahne D, Walker S, Marks DS, Rudner DZ, Bernhardt TG, Kruse ACStructural coordination of polymerization and crosslinking by a SEDS-bPBP peptidoglycan synthase complex.Nature microbiology. 2020 Jun; 5(6):813-820. PMID: 32152588
Dion MF, Kapoor M, Sun Y, Wilson S, Ryan J, Vigouroux A, van Teeffelen S, Oldenbourg R, Garner EC Bacillus subtilis cell diameter is determined by the opposing actions of two distinct cell wall synthetic systems. Nature microbiology. 2019 Aug; 4(8):1294-1305. doi:10.1038/s41564-019-0439-0. PMID:31086310
Lages MC, Beilharz K, Morales Angeles D, Veening JW, Scheffers DJ The localization of key Bacillus subtilis penicillin binding proteins during cell growth is determined by substrate availability. Environmental microbiology. 2013 Dec; 15(12):3272-81. doi:10.1111/1462-2920.12206. PMID:23895585
Yoshida H, Kawai F, Obayashi E, Akashi S, Roper DI, Tame JR, Park SY Crystal structures of penicillin-binding protein 3 (PBP3) from methicillin-resistant Staphylococcus aureus in the apo and cefotaxime-bound forms. Journal of molecular biology. 2012 Oct 26; 423(3):351-64. doi:10.1016/j.jmb.2012.07.012. pii:S0022-2836(12)00579-7. PMID:22846910
Lehnik-Habrink M, Schaffer M, Mäder U, Diethmaier C, Herzberg C, Stülke J RNA processing in Bacillus subtilis: identification of targets of the essential RNase Y. Molecular microbiology. 2011 Sep; 81(6):1459-73. doi:10.1111/j.1365-2958.2011.07777.x. PMID:21815947
Garner EC, Bernard R, Wang W, Zhuang X, Rudner DZ, Mitchison T Coupled, circumferential motions of the cell wall synthesis machinery and MreB filaments in B. subtilis. Science (New York, N.Y.). 2011 Jul 08; 333(6039):222-5. doi:10.1126/science.1203285. PMID:21636745
Domínguez-Escobar J, Chastanet A, Crevenna AH, Fromion V, Wedlich-Söldner R, Carballido-López R Processive movement of MreB-associated cell wall biosynthetic complexes in bacteria. Science (New York, N.Y.). 2011 Jul 08; 333(6039):225-8. doi:10.1126/science.1203466. PMID:21636744
Hyyryläinen HL, Marciniak BC, Dahncke K, Pietiäinen M, Courtin P, Vitikainen M, Seppala R, Otto A, Becher D, Chapot-Chartier MP, Kuipers OP, Kontinen VP Penicillin-binding protein folding is dependent on the PrsA peptidyl-prolyl cis-trans isomerase in Bacillus subtilis. Molecular microbiology. 2010 Jul 01; 77(1):108-27. doi:10.1111/j.1365-2958.2010.07188.x. PMID:20487272
Voigt B, Antelmann H, Albrecht D, Ehrenreich A, Maurer KH, Evers S, Gottschalk G, van Dijl JM, Schweder T, Hecker M Cell physiology and protein secretion of Bacillus licheniformis compared to Bacillus subtilis. Journal of molecular microbiology and biotechnology. 2009; 16(1-2):53-68. doi:10.1159/000142894. PMID:18957862
Scheffers DJ, Jones LJ, Errington J Several distinct localization patterns for penicillin-binding proteins in Bacillus subtilis. Molecular microbiology. 2004 Feb; 51(3):749-64. . PMID:14731276
Wei Y, Havasy T, McPherson DC, Popham DL Rod shape determination by the Bacillus subtilis class B penicillin-binding proteins encoded by pbpA and pbpH. Journal of bacteriology. 2003 Aug; 185(16):4717-26. . PMID:12896990
Murray T, Popham DL, Pearson CB, Hand AR, Setlow P Analysis of outgrowth of Bacillus subtilis spores lacking penicillin-binding protein 2a. Journal of bacteriology. 1998 Dec; 180(24):6493-502. . PMID:9851991
Murray T, Popham DL, Setlow P Identification and characterization of pbpA encoding Bacillus subtilis penicillin-binding protein 2A. Journal of bacteriology. 1997 May; 179(9):3021-9. . PMID:9139922

3B4F035535D6504405567E7C44E72902A11F7447

Page visits: 6477

Time of last update: 2025-04-13 08:26:27

Author of last update: Jstuelk