mreBH

mreBH
168

cell shape-determining protein, forms filaments, the polymers control/restrict the mobility of the cell wall elongation enzyme complex, required for LytE activity

Locus
BSU_14470
Molecular weight
35.53 kDa
Isoelectric point
5.24
Protein length
335 aaSequenceBlast
Gene length
1008 bpSequenceBlast
Function
cell shape determation
Product
cell shape-determining protein
Essential
no
Synonyms
mreBH
Outlinks
BsubCyc SubtiList UniProt STRING Genoscapist PaperBLAST

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1077 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,516,574  1,517,581
The protein
Catalyzed reaction/ biological activity
forms ring-shaped filaments in a heterologous system PubMed
required for the activity of LytE PubMed
Protein family
FtsA/MreB family (according to UniProt)
Structure
1JCF (PDB) (MreB from Thermotoga maritima, 52% identity) PubMed
P39763 (AlphaFold)
Paralogous protein(s)
Mbl, MreB
Localization
during logarithmic growth, MreBH forms discrete patches thst move processively along peripheral tracks perpendicular to the cell axis PubMed
forms transverse bands as cells enter the stationary phase PubMed
close to the inner surface of the cytoplasmic membrane PubMed
reports on helical structures formed by MreBH PubMed seem to be misinterpretation of data PubMed
normal localization depends on the presence of glucolipids, MreB forms irregular clusters in an ''ugtP'' mutant PubMed
Expression and Regulation
Operons
Genes
mreBH-ykpC
Description
PubMed
Regulation
expression is increased in an ugtP mutant PubMed
induced at high temperature (SigI, WalR) PubMed
Regulatory mechanism
WalR: activation, PubMed, in walR regulon
Sigma factors
SigI: sigma factor, PubMed, in sigI regulon
Open in new tab

mreBH→ykpC

2025-03-17 19:14:20

Bzhu

103

7cc47a93f26f6b572b81b00be5d01512884305bd

130C5D74C19DDEB65F1EE7AD141A8B90C2CCF0F3

Biological materials
Mutant
BKE14470 (mreBH::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTTTCACCCAATCTCT,  downstream forward: _UP4_TAGTCTTTACCCGCAAAATT
BKK14470 (mreBH::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTTTCACCCAATCTCT,  downstream forward: _UP4_TAGTCTTTACCCGCAAAATT
References
Other original publications
Ramaniuk O, Převorovský M, Pospíšil J, Vítovská D, Kofroňová O, Benada O, Schwarz M, Šanderová H, Hnilicová J, Krásný L σ from : Impact on Gene Expression and Characterization of σ-dependent Transcription that Requires New Types of Promoters with Extended -35 and -10 Elements. Journal of bacteriology. 2018 Jun 18; . pii:JB.00251-18. doi:10.1128/JB.00251-18. PMID:29914988
Reuß DR, Altenbuchner J, Mäder U, Rath H, Ischebeck T, Sappa PK, Thürmer A, Guérin C, Nicolas P, Steil L, Zhu B, Feussner I, Klumpp S, Daniel R, Commichau FM, Völker U, Stülke J Large-scale reduction of the Bacillus subtilis genome: consequences for the transcriptional network, resource allocation, and metabolism. Genome research. 2017 Feb; 27(2):289-299. doi:10.1101/gr.215293.116. PMID:27965289
Huang WZ, Wang JJ, Chen HJ, Chen JT, Shaw GC The heat-inducible essential response regulator WalR positively regulates transcription of sigI, mreBH and lytE in Bacillus subtilis under heat stress. Research in microbiology. 2013 Dec; 164(10):998-1008. doi:10.1016/j.resmic.2013.10.003. pii:S0923-2508(13)00188-5. PMID:24125693
Muchová K, Chromiková Z, Barák I Control of Bacillus subtilis cell shape by RodZ. Environmental microbiology. 2013 Dec; 15(12):3259-71. doi:10.1111/1462-2920.12200. PMID:23879732
Domínguez-Cuevas P, Porcelli I, Daniel RA, Errington J Differentiated roles for MreB-actin isologues and autolytic enzymes in Bacillus subtilis morphogenesis. Molecular microbiology. 2013 Sep; 89(6):1084-98. doi:10.1111/mmi.12335. PMID:23869552
Matsuoka S, Chiba M, Tanimura Y, Hashimoto M, Hara H, Matsumoto K Abnormal morphology of Bacillus subtilis ugtP mutant cells lacking glucolipids. Genes & genetic systems. 2011; 86(5):295-304. . PMID:22362028
Dempwolff F, Reimold C, Reth M, Graumann PL Bacillus subtilis MreB orthologs self-organize into filamentous structures underneath the cell membrane in a heterologous cell system. PloS one. 2011; 6(11):e27035. doi:10.1371/journal.pone.0027035. PMID:22069484
Soufo HJ, Graumann PL Bacillus subtilis MreB paralogues have different filament architectures and lead to shape remodelling of a heterologous cell system. Molecular microbiology. 2010 Dec; 78(5):1145-58. doi:10.1111/j.1365-2958.2010.07395.x. PMID:21091501
Kawai Y, Asai K, Errington J Partial functional redundancy of MreB isoforms, MreB, Mbl and MreBH, in cell morphogenesis of Bacillus subtilis. Molecular microbiology. 2009 Aug; 73(4):719-31. doi:10.1111/j.1365-2958.2009.06805.x. PMID:19659933
Schirner K, Errington J Influence of heterologous MreB proteins on cell morphology of Bacillus subtilis. Microbiology (Reading, England). 2009 Nov; 155(Pt 11):3611-21. doi:10.1099/mic.0.030692-0. PMID:19643765
Tseng CL, Shaw GC Genetic evidence for the actin homolog gene mreBH and the bacitracin resistance gene bcrC as targets of the alternative sigma factor SigI of Bacillus subtilis. Journal of bacteriology. 2008 Mar; 190(5):1561-7. . PMID:18156261
Carballido-López R, Formstone A, Li Y, Ehrlich SD, Noirot P, Errington J Actin homolog MreBH governs cell morphogenesis by localization of the cell wall hydrolase LytE. Developmental cell. 2006 Sep; 11(3):399-409. . PMID:16950129
van den Ent F, Amos LA, Löwe J Prokaryotic origin of the actin cytoskeleton. Nature. 2001 Sep 06; 413(6851):39-44. . PMID:11544518
Localization
Dersch S, Reimold C, Stoll J, Breddermann H, Heimerl T, Defeu Soufo HJ, Graumann PLPolymerization of Bacillus subtilis MreB on a lipid membrane reveals lateral co-polymerization of MreB paralogs and strong effects of cations on filament formation.BMC molecular and cell biology. 2020 Nov 4; 21(1):76. PMID: 33148162
Matsuoka S, Chiba M, Tanimura Y, Hashimoto M, Hara H, Matsumoto K Abnormal morphology of Bacillus subtilis ugtP mutant cells lacking glucolipids. Genes & genetic systems. 2011; 86(5):295-304. . PMID:22362028
Garner EC, Bernard R, Wang W, Zhuang X, Rudner DZ, Mitchison T Coupled, circumferential motions of the cell wall synthesis machinery and MreB filaments in B. subtilis. Science (New York, N.Y.). 2011 Jul 08; 333(6039):222-5. doi:10.1126/science.1203285. PMID:21636745
Domínguez-Escobar J, Chastanet A, Crevenna AH, Fromion V, Wedlich-Söldner R, Carballido-López R Processive movement of MreB-associated cell wall biosynthetic complexes in bacteria. Science (New York, N.Y.). 2011 Jul 08; 333(6039):225-8. doi:10.1126/science.1203466. PMID:21636744
Strahl H, Hamoen LW Membrane potential is important for bacterial cell division. Proceedings of the National Academy of Sciences of the United States of America. 2010 Jul 06; 107(27):12281-6. doi:10.1073/pnas.1005485107. PMID:20566861
Defeu Soufo HJ, Graumann PL Dynamic localization and interaction with other Bacillus subtilis actin-like proteins are important for the function of MreB. Molecular microbiology. 2006 Dec; 62(5):1340-56. . PMID:17064365

40829C3632E9DCEB9E1C14A674B4B217F504CFE0

Page visits: 4501

Time of last update: 2025-04-11 00:28:07

Author of last update: TPed