yhdY

yhdY
168

mechanosensitive channel, similar to MscS

Locus
BSU_09640
Molecular weight
42.38 kDa
Isoelectric point
5.76
Protein length
Gene length
Function
resistance to osmotic downshock
Product
mechanosensitive channel, similar to MscS
Essential
no
Synonyms
yhdY

Genomic Context

List of homologs in different organisms, belongs to COG0668 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,038,909  1,040,024
The protein
Protein family
MscS (TC 1.A.23) family (according to UniProt)
Structure
4AGE (PDB) (MscS from E. coli, corresponds to aa 129 ... 358 of YhdY, 27% identity) PubMed
cell membrane (according to UniProt)
Expression and Regulation
Operons
Genes
Description
Open in new tab

yhdY

2025-03-15 23:15:28

Jstuelk

55

c9eb5254864250857210d13055f05771a7bbf1b4

9C6592FDB7105CC739ED109D40ECB38451B6971A

Additional information
the mRNA is cleaved by RNase III PubMed
Biological materials
Mutant
MGNA-A701 (yhdY::erm), available at the NBRP B. subtilis, Japan
1A958 ( yhdY::erm), PubMed, available at BGSC
1A958 ( yhdY::erm), PubMed, available at BGSC
BKE09640 (yhdY::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATGACTGTCTCCCCTCTAT,  downstream forward: _UP4_TAAAAGAGAGACTTCGTCTG
BKK09640 (yhdY::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATGACTGTCTCCCCTCTAT,  downstream forward: _UP4_TAAAAGAGAGACTTCGTCTG
References
Reviews
Johnson SC, Veres J, Malcolm HRExploring the diversity of mechanosensitive channels in bacterial genomes.European biophysics journal : EBJ. 2021 Jan; 50(1):25-36. PMID: 33244613
Booth IR Bacterial mechanosensitive channels: progress towards an understanding of their roles in cell physiology. Current opinion in microbiology. 2014 Apr; 18:16-22. doi:10.1016/j.mib.2014.01.005. pii:S1369-5274(14)00007-1. PMID:24607989
Booth IR, Blount P The MscS and MscL families of mechanosensitive channels act as microbial emergency release valves. Journal of bacteriology. 2012 Sep; 194(18):4802-9. doi:10.1128/JB.00576-12. PMID:22685280
Naismith JH, Booth IR Bacterial mechanosensitive channels--MscS: evolution's solution to creating sensitivity in function. Annual review of biophysics. 2012; 41:157-77. doi:10.1146/annurev-biophys-101211-113227. PMID:22404681
Booth IR, Edwards MD, Black S, Schumann U, Miller S Mechanosensitive channels in bacteria: signs of closure? Nature reviews. Microbiology. 2007 Jun; 5(6):431-40. . PMID:17505523
Pivetti CD, Yen MR, Miller S, Busch W, Tseng YH, Booth IR, Saier MH Two families of mechanosensitive channel proteins. Microbiology and molecular biology reviews : MMBR. 2003 Mar; 67(1):66-85, table of contents. . PMID:12626684
Original Publications
Zhang Y, Daday C, Gu RX, Cox CD, Martinac B, de Groot BL, Walz TVisualization of the mechanosensitive ion channel MscS under membrane tension.Nature. 2021 Feb; 590(7846):509-514. PMID: 33568813
DiChiara JM, Liu B, Figaro S, Condon C, Bechhofer DH Mapping of internal monophosphate 5' ends of Bacillus subtilis messenger RNAs and ribosomal RNAs in wild-type and ribonuclease-mutant strains. Nucleic acids research. 2016 Apr 20; 44(7):3373-89. doi:10.1093/nar/gkw073. PMID:26883633
Pliotas C, Ward R, Branigan E, Rasmussen A, Hagelueken G, Huang H, Black SS, Booth IR, Schiemann O, Naismith JH Conformational state of the MscS mechanosensitive channel in solution revealed by pulsed electron-electron double resonance (PELDOR) spectroscopy. Proceedings of the National Academy of Sciences of the United States of America. 2012 Oct 02; 109(40):E2675-82. doi:10.1073/pnas.1202286109. PMID:23012406
Lehnik-Habrink M, Schaffer M, Mäder U, Diethmaier C, Herzberg C, Stülke J RNA processing in Bacillus subtilis: identification of targets of the essential RNase Y. Molecular microbiology. 2011 Sep; 81(6):1459-73. doi:10.1111/j.1365-2958.2011.07777.x. PMID:21815947
Wahome PG, Cowan AE, Setlow B, Setlow P Levels and localization of mechanosensitive channel proteins in Bacillus subtilis. Archives of microbiology. 2009 May; 191(5):403-14. doi:10.1007/s00203-009-0465-z. PMID:19252899
Hoffmann T, Boiangiu C, Moses S, Bremer E Responses of Bacillus subtilis to hypotonic challenges: physiological contributions of mechanosensitive channels to cellular survival. Applied and environmental microbiology. 2008 Apr; 74(8):2454-60. doi:10.1128/AEM.01573-07. PMID:18310427
Wahome PG, Setlow P Growth, osmotic downshock resistance and differentiation of Bacillus subtilis strains lacking mechanosensitive channels. Archives of microbiology. 2008 Jan; 189(1):49-58. . PMID:17665170
Labs working on this gene/protein
Erhard Bremer, University of Marburg, Germany homepage

50DC162B3A7798F8D10B8373968AD333F197360B

Page visits: 2216

Time of last update: 2025-04-06 01:38:09

Author of last update: Jstuelk