opuE

opuE
168

proline transporter

Locus
BSU_06660
Molecular weight
53.12 kDa
Isoelectric point
9.81
Protein length
Gene length
Function
compatible solute transport
Product
proline transporter
Essential
no
Synonyms
opuE, yerK

Genomic Context

List of homologs in different organisms, belongs to COG0591 (Galperin et al., 2021)

This gene is a member of the following regulons

CcpA regulon, SigB regulon

Gene
Coordinates
726,840  728,318
Phenotypes of a mutant
strong growth disadvantage in high-salinity minimal media lacking proline PubMed
The protein
Protein family
Structure
Paralogous protein(s)
cell membrane (according to UniProt)
Expression and Regulation
Operons
Genes
Description
Regulation
induced by glucose (CcpA) PubMed
Regulatory mechanism
CcpA: activation, PubMed, in ccpA regulon
Sigma factors
SigB: sigma factor, PubMed, in sigB regulon
Additional information
the mRNA is very stable (half-life > 15 min) PubMed
Open in new tab

opuE

2025-04-05 22:46:24

ghost

119

4371b776c104e79e77889ccb95558d0e15e1e5fc

89417D1ED9EEFA62675D65EC2631C80FC5E615E8

Biological materials
Mutant
GP4688 (trpC2 ΔopuE::neo), available in Jörg Stülke's lab
available in Erhard Bremer's lab PubMed
BKE06660 (opuE::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CACGTTTTACCCTCTCTTCA,  downstream forward: _UP4_TAAGCAATAAGCCATCAAGC
BKK06660 (opuE::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CACGTTTTACCCTCTCTTCA,  downstream forward: _UP4_TAAGCAATAAGCCATCAAGC
Labs working on this gene/protein
Erhard Bremer, University of Marburg, Germany homepage
References
Reviews
Hoffmann T, Bremer E Guardians in a stressful world: the Opu family of compatible solute transporters from Bacillus subtilis. Biological chemistry. 2017 Feb 01; 398(2):193-214. doi:10.1515/hsz-2016-0265. pii:/j/bchm.2017.398.issue-2/hsz-2016-0265/hsz-2016-0265.xml. PMID:27935846
Original Publications
Gao GR, Wei SY, Ding MZ, Hou ZJ, Wang DJ, Xu QM, Cheng JS, Yuan YJEnhancing fengycin production in the co-culture of Bacillus subtilis and Corynebacterium glutamicum by engineering proline transporter.Bioresource technology. 2023 May 25; 383:129229. PMID: 37244302
Bracher S, Guérin K, Polyhach Y, Jeschke G, Dittmer S, Frey S, Böhm M, Jung H Glu-311 in External Loop 4 of the Sodium/Proline Transporter PutP Is Crucial for External Gate Closure. The Journal of biological chemistry. 2016 Mar 04; 291(10):4998-5008. doi:10.1074/jbc.M115.675306. PMID:26728461
Zaprasis A, Hoffmann T, Stannek L, Gunka K, Commichau FM, Bremer E The γ-aminobutyrate permease GabP serves as the third proline transporter of Bacillus subtilis. Journal of bacteriology. 2014 Feb; 196(3):515-26. doi:10.1128/JB.01128-13. PMID:24142252
Marciniak BC, Pabijaniak M, de Jong A, Dűhring R, Seidel G, Hillen W, Kuipers OP High- and low-affinity cre boxes for CcpA binding in Bacillus subtilis revealed by genome-wide analysis. BMC genomics. 2012 Aug 17; 13:401. doi:10.1186/1471-2164-13-401. PMID:22900538
Hoffmann T, von Blohn C, Stanek A, Moses S, Barzantny H, Bremer E Synthesis, release, and recapture of compatible solute proline by osmotically stressed Bacillus subtilis cells. Applied and environmental microbiology. 2012 Aug; 78(16):5753-62. doi:10.1128/AEM.01040-12. PMID:22685134
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Moses S, Sinner T, Zaprasis A, Stöveken N, Hoffmann T, Belitsky BR, Sonenshein AL, Bremer E Proline utilization by Bacillus subtilis: uptake and catabolism. Journal of bacteriology. 2012 Feb; 194(4):745-58. doi:10.1128/JB.06380-11. PMID:22139509
Hambraeus G, von Wachenfeldt C, Hederstedt L Genome-wide survey of mRNA half-lives in Bacillus subtilis identifies extremely stable mRNAs. Molecular genetics and genomics : MGG. 2003 Aug; 269(5):706-14. . PMID:12884008
von Blohn C, Kempf B, Kappes RM, Bremer E Osmostress response in Bacillus subtilis: characterization of a proline uptake system (OpuE) regulated by high osmolarity and the alternative transcription factor sigma B. Molecular microbiology. 1997 Jul; 25(1):175-87. . PMID:11902719
von Blohn C, Kempf B, Kappes RM, Bremer E Osmostress response in Bacillus subtilis: characterization of a proline uptake system (OpuE) regulated by high osmolarity and the alternative transcription factor sigma B. Molecular microbiology. 1997 Jul; 25(1):175-87. . PMID:11902719
Spiegelhalter F, Bremer E Osmoregulation of the opuE proline transport gene from Bacillus subtilis: contributions of the sigma A- and sigma B-dependent stress-responsive promoters. Molecular microbiology. 1998 Jul; 29(1):285-96. . PMID:9701821

6A1F759DAC09D364602460E5467E2761E97CE45C

Page visits: 4940

Time of last update: 2025-04-06 02:15:03

Author of last update: Robert.warneke