feuC

feuC
168

ABC transporter for the siderophores Fe-enterobactin and Fe-bacillibactin (integral membrane protein)

Locus
BSU_01610
Molecular weight
42.91 kDa
Isoelectric point
10.44
Protein length
Gene length
Product
ABC transporter for the siderophores Fe-enterobactin and Fe-bacillibactin (integral membrane protein)
Essential
no
Synonyms
feuC

Genomic Context

List of homologs in different organisms, belongs to COG0609 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, Fur regulon, Btr regulon

Gene
Coordinates
180,344 → 181,354
Phenotypes of a mutant
severe growth inhibition upon addition of subinhibitory concentrations of mirubactin C PubMed
The protein
Protein family
Structure
4G1U (PDB) (heme transporter from Yersinia pestis, 31% identity) PubMed
Paralogous protein(s)
cell membrane PubMed
Expression and Regulation
Operons
Description
Regulation
expression during spore germination is strongly reduced under conditions of osmotic stress PubMed
induced by iron starvation (second wave to allow iron scavenging from the environment) (Fur) PubMed
Regulatory mechanism
Fur: repression, PubMed, in fur regulon
Btr: activation, in the presence of the co-activators bacillibactin or enterobactin PubMed, in btr regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Additional information
the presence of an iron-responsive element bound by CitB between ''feuA and feuB'' suggests iron-dependent regulation by CitB PubMed
Open in new tab

feuAybbA

2025-03-16 16:54:39

Jstuelk

118

c6ed9c562a4c7db452ebc8903a1989d0bb2f0947

A3C1B309E9C3034B9896B74BA25621D2CF69902F

Other regulations
CitB: translation control
Biological materials
Mutant
BKE01610 (ΔfeuC::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CAAAGCGATGAACAATGCAT,  downstream forward: _UP4_AAGCAAAAAAAGGGGGAGAA
BKK01610 (ΔfeuC::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CAAAGCGATGAACAATGCAT,  downstream forward: _UP4_AAGCAAAAAAAGGGGGAGAA
References
Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
O'Reilly FJ, Graziadei A, Forbrig C, Bremenkamp R, Charles K, Lenz S, Elfmann C, Fischer L, Stülke J, Rappsilber JProtein complexes in cells by AI-assisted structural proteomics.Molecular systems biology. 2023 Feb 23; :e11544. PMID: 36815589
Kepplinger B, Wen X, Tyler AR, Kim BY, Brown J, Banks P, Dashti Y, Mackenzie ES, Wills C, Kawai Y, Waldron KJ, Allenby NEE, Wu LJ, Hall MJ, Errington JMirubactin C rescues the lethal effect of cell wall biosynthesis mutations in Bacillus subtilis.Frontiers in microbiology. 2022; 13:1004737. PMID: 36312962
Pi H, Helmann JD Sequential induction of Fur-regulated genes in response to iron limitation in Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America. 2017 Nov 13; . pii:201713008. doi:10.1073/pnas.1713008114. PMID:29133393
Woo JS, Zeltina A, Goetz BA, Locher KP X-ray structure of the Yersinia pestis heme transporter HmuUV. Nature structural & molecular biology. 2012 Dec; 19(12):1310-5. doi:10.1038/nsmb.2417. PMID:23142986
Peuckert F, Miethke M, Albrecht AG, Essen LO, Marahiel MA Structural basis and stereochemistry of triscatecholate siderophore binding by FeuA. Angewandte Chemie (International ed. in English). 2009; 48(42):7924-7. doi:10.1002/anie.200902495. PMID:19746494
Gaballa A, Helmann JD Substrate induction of siderophore transport in Bacillus subtilis mediated by a novel one-component regulator. Molecular microbiology. 2007 Oct; 66(1):164-73. . PMID:17725565
Miethke M, Klotz O, Linne U, May JJ, Beckering CL, Marahiel MA Ferri-bacillibactin uptake and hydrolysis in Bacillus subtilis. Molecular microbiology. 2006 Sep; 61(6):1413-27. . PMID:16889643
Ollinger J, Song KB, Antelmann H, Hecker M, Helmann JD Role of the Fur regulon in iron transport in Bacillus subtilis. Journal of bacteriology. 2006 May; 188(10):3664-73. . PMID:16672620
Baichoo N, Wang T, Ye R, Helmann JD Global analysis of the Bacillus subtilis Fur regulon and the iron starvation stimulon. Molecular microbiology. 2002 Sep; 45(6):1613-29. . PMID:12354229
Alén C, Sonenshein AL Bacillus subtilis aconitase is an RNA-binding protein. Proceedings of the National Academy of Sciences of the United States of America. 1999 Aug 31; 96(18):10412-7. . PMID:10468622
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453

F38F6D4841B3044EA0496B3A1C1D484018BDFEA4

Page visits: 4347

Time of last update: 2025-04-06 12:50:22

Author of last update: Jstuelk